ribosomal protein L36A

cDNA: Genbank NM_173262

 

hi10 is in the third intron

 

agatcttttcatacatttcctaacatccaaatccctcccattttgagact

gaccgtaatgtgatgtaggagtgcggtttcccggcccactgaattgattg

acagccacgtattaacatttctccttaataacgcataaagtcatatcaac

aagacaagacatgcgcaaagcaactgggattatataaatcaacaaatata

atcaagaatgagttttacatgacgttaaatcaggttcgttttgcacatta

acataaccataacataacggatcttccatacagcagtggatatcaacatg

catagtgtcacatttatcttgcaaaagcagtgtgaagcttaacttcgtaa

cgatattgtgtgactcattatcacagaagggcttgaattaacaaatacgt

caaattctcattagtaaagttcttactgtagtatttcccacaaatgttac

gtgaaatctgcttccatcatgtctgtcactgtgctgtttatctgacgcag

ttggagacaggaacactctgacagatgcgtgggggaatggtgggtgagga

aagccagcattaaaaccacacgttgaggtaacaaaaacagctacaaaatg

ttcaaagcataaaattacaaactcctgaaaggtataataataaatgtgat

gtgatctggtgttttgagcttaaactttacaaagactttctggtggcaca

aaacacttaccttaaatcttgaaaaaggggtaaaataggtgccctttaac

ttagtaagaacattcatacgaataattaacagcagatattttgaggcgtt

tgctcgacatctagtttttagtaaaagctgacattcttatgactttcaac

aacaattcttgcttaatattaatgcttgataaagcgtcttaccatatttt

ctgactaacgttcgctgaatgacaaaaaagaaacgatgtttaagtgtgtg

tttagaaacgtttaccgttgtagtcacgtttcaagaaaacaccgcaaaaa

acatttttgcagattattatcgagcttcagcgttgtcgttggcattataa

atagctatatcaatggtctcactcATATGTGCGGAGCGGACAGTGTGTTT

GGTATGTCGACCGTTAGGTGGTAGCATCATCACGCAGCAGCAGCAGCAGC

AAACAGCGCGAGAGTCTCTTGCGCGACCCGGTACTAATGCTCTGAGTGAC

GTCTATACTTCCTCTTTGCTCCTGCGGCGCGAGGGCAACCATGgtgcgta

atattgtcctgtggagcttcatcctaaatctgttttaatcttaaatatgt

ggacatcctaggttcatacaaacagcacaataagaatgtatacagtctca

gcttcatattaaatgttttattgagtcgtttatataatgaatgagatgat

tatttgtatgtatttagtgcttccctgactcgtaatgtcgccgctttagc

tctaaccgtgtacgattgttacaatacatagttttattaaagcaataccc

ttgtgccttttatgtaattgaatgcattttcacatctgttaacttgagaa

aattgtgtacatttcatggaaacgctgattagcttaaatgctacttcgtt

taacttagcgtgtctttagtgatctcagaccgcagatttcagtaatgcta

aatgtgtttctctccagGTAAACGTACCGAAGACCCGCAGGACGTACTGC

AAAAAATGCAAGAAACACCAGCCGCATAAAGTGACCCAGTACAAGAAGGG

TAAAGACTCTCTGTACGCCCAGGgtaagtccagagagctgacagagacga

ccggcgtgtagacctgactggctgaagaattaattgcgtttgtttacctg

tgtattatagGAAAGAGGCGTTACGACAGAAAGCAGAGTGGTTATGGAGG

ACAGACCAAGCCTATTTTCCGAAAAAAGgtatgtcggtcatgcaggagta

tgtatgcaagcaagggttgccatgtgtaagttaaagtaatatttatgagt

gtgggatttacagggttcccacacttcttaaagtacttcaatttcagaca

tatggatgcaagtcctggaaagtacttaaaccagcacagattcttgaaag

cgcctaaattaaatttgtttatgggttgatttcaacaattgtactgtcaa

agacagtgacgtttctttagtattgatgcagaaccagaacttgctactta

aaaaattgttaatcttctacaataacacagacaaattacacagtttatca

gtattttagaaatcgaaattgaatat

hi10 (5-3)

caccagtacggaattcagcaattttattatagttcttaaaaatggtcaag

ttttgaaaattactctgacattttaatgtaaatagtaagtataagtaaaa