casein kinase 1, alpha 1

cDNA: Genbank AY099516

 

hi1002 and hi2069 are both in the 2nd intron

 

cgtacccacaggttcgttgacatcacgcgtgaacccctcccctgcccgcg

gcggcgcgctttagcgcggtctcgctcctctcttcagatcagcagaatct

GTTCATCCCGAGACGGACaaGATGGCGAAGTGAGTGGGTTGCGCTTTGAA

GAGAAAGCAGCGACTCACAAAAATTCTTCAACGTTAAAACGTCGGTTGCC

TTGATGTTCGTTCAAATAAGCGGGAAAACGCATCTTTAAGAAGAAAAATC

GCCCCTCAGAGCGAGGTGAATCGAAGAGAGCGTCGAGGACATCGACTCCT

CCGTGTCCTTTCAGGCTAAGCTGCTAGTCAGCTATTCGGGGAATTGCTCA

AGAGAAAAAACAGCCTCAACCTCAGGGGAAATAGTCTTGTTTTTTTTTTT

TACTTAAATGTCGAGGCAGCAAAACTTATATTGAAACCGATGTCCGTTAT

CATCTTCATTTCGTCGTTGTGAGTTAAGGACACAGCTAGTAAGGAAGAGC

CGTTTTTAGGCTAGCTAGCATTGTTTCTACTGGACTGAAGAAGAGAGCTG

CCTGAAAACCTCGCCCGTTTACaCAGTTTCAGTGTACTTCTCGGATTTTA

GGACATGGCCAGCAGCAGTGGCTCTAAAGCCGAGTTTATAGTCGGTGGGA

AATACAAGCTCGTTCGTAAAATCGGATCTGGATCCTTCGGTGACATTTAT

TTGGCAATCAACATCACAAATGGAGAGgtaaaatgaaatggatgtgtaat

tcttgtgctgaatgactgggataagaagattgagcggtttatacgtgtgt

ccagctcaacaagtctgattaccagaacattaaagtccatatggtttcca

aacatatagttggtgtaacgttagccctgaaagattaacggatattcata

tttgtacgacttgtttatgagaaaccaatcaacgataactcgttgcagat

tggattaaacatttctttaagatcctgtcctgtcaaatctttaactattt

tcaatgtttcgccactaatctgtgagtttttggtaaatgagcattatttt

tattataatttcagGAGGTAGCTGTGAAATTGGAATCACAGAAAGCCAGA

CATCCTCAACTCCTATATGAAAGCAAATTGTACAAAATTCTCCAGGGAGG

AGTCGGGATCCCACACATCAGgtgagtaacttcagattatatcagacatt

attatggattttgtggtaacattagctgaactagtttgatctggctgagg

gactaagggtagcttaagatcgaaagcaacgcatcgaggagcgttacaga

gtaactc

hi1002 (3-5)

gcatttgtcaacgtatattaaacgtctcaatggtttatgcatcgatctta

atgacattagtgtcttactgttatgtttagttttacggttatgatatagc

atcagcaggctaactagcccgttcattagcgctaggttttcaccgcgtcg

cttgaaagaacggtggtgaaatgtcttcaaacaatacgtgctctgtaaaa

tggattattatattgtaaagcgagtaagatttgatcacttattac

hi2069 (3-5)

atgtgtttgtgtgttgctgagtaatgagtaaagagcgagtgggaaatggc

cgctgctcttttgttgtgtttgttcaacatgtcctccctctcgatcagaa

aatggcggatgagagaaaacaagtttcagggcctagcgagtctgctgctg

tcttctcaaggtgactgagccttaccagggctgctgtttgtgtcaaaatg

ttgattctttttcatatatatatatatatatatatagagagagagagaaa

aaaacatatgagataaaggctcacatagggtgcctcaagtaattaattct

agtcacattataattaatgacgtactgtgactgtattctctgtcgcgtat

tcttatttttatcttaattaattcaaacgtcatactttgcgattgcagaa

gttccctatttcccaatgtttataggtggttgagctagggtaaatgtttt

tatttgctgtttcctcacaactatgtttatgttttctaagctacttgacg

ttgtgccttattaacctagtttaacctttatttcaagacatttgagagcc

tgtgggtgagtgggccttatctttctaaaatgcactcagatcagatgact

ttgcataaaaatgccagagaaacttttaattagtcacaaaaggacttttg

aatgttttgtggagatgaatttgttttgtacctaaggtagacgttaagat

cttagatgttaattcatgtaactgcaaaattaaaaattaaagtaatatgg

taaggtgtgttcgtgtttaattgccctggcacccttacagataagtcttt

atcttcttttttttcctccccttgaagctccgctcttggctctattactt

gggtaattaaaaattaactttgctgtagatgtcaaatcaacgagagatag

cgtttagtttctattaaacactctttatattcactatgtcccacagatct

gaaatttctttgaggtggaaaagataccaagataaataacatgtgacctt

taatgcatcttatagaattatatgttaatcacaaaagaataaattttatt

tcagtattcaatattgatttgcatgaccagtttgatcctattctttcacc

cctattccccttaaattaattgcatttgctttgaaaattcacataacagc

attaaatatggcaaaagcttagtttcttgcaacgtttcacaccatattat

ttctgcttagctagctttctttcctagaaatgtcataaatgcttaccagc

catgagttttgctagtttcacatttaatcgtacactaatatatcatttag

taaagtagttcagctgacaaatttcacctggtaatatcagtataaacaag

aatgccctgcctttgccataaatgacctgccattacagacttgcgtttag

gtgtccatttctgtggcatctcatgctgacagaaatttgaactcctggac

catagctggttatttaaccctgagcaattaagagttaggtaacttatgtc

gttgttggatttaccaaacaatttaaaaatgagattcaagcaatagtgtc

aactaaagccatctttattaaacttttaagtagtttctttagtgctttta

atttgagtgttatttgggtgatttttttttttttttttaagaactggatt

gatttgttttaaagcaagtgtatttagttatcgtaggagtttttttctca

gaaaaaaagccacttaaaccactttataatgactgtattaaagtttccag

cgaatgatgtgtaataccggtttcagtcgctggttactagagcttggaaa

acctgccatacgagatcttcctcccccacactacctaaaatcactcagag

cctttcctgatgaaagaaaaaaactttgtgtgctgttcaaagtctatcat

gtaaactcaatcacagaaaagtgtcttctcactctttttaaatgtatata

cattaccatcacacctctttgggattatttagttaaaatattcaggcgaa

ctacactttttttttcttcagccttcctcttagttttgaaaagaggaaat

gagtttcccacagagagaggcctgtagtttccgtgagcgatttctgttga

tatgaacttctgtaactagtttagatgacagcatgcttatgaaacgtgag

cttttattaggttaaatttaatgcatattacattgttgtagtcatagagg

tatgtgaacgtgtataattttgtacacacgagcaacactgataataaact

ggaataaaaaaaaaaacttttcactgtgttcataacagcagctagcatga

atgccattacttctgacatataaacaagcaagaattaggagtcggcttgt

ggttcaaagtacattttgcattgtcattatgaaatgctagatgttggctc

tctggcacagacggccgaatgaacactagtctgctgctgcaccttgtgtc

tccacaatacctctttgtttgggagactcactagcaggatggttgcttag

agactgctgtggcagtgtgttcactaaatgcatgactcttttgaacctcc

acctgctcgattttgtttgagttctgattgtcaaacttgtgctgatattc

gtaagaaccccctaactgatttgatgcaggatttggctataaacaattta

agtacgctacttttttcttttgttctgggctgttcatggtggagcaaagt

tgttgagtggtgcttttggtttaaagtggtttgttaaagactttattggc

ctagttgctactgtggactctactctgagtcatgtcacccagctggatat

attggatgccattgtctaaagggtgtgccatgtaactcagacacttccct

tgctgataagatttatgctgctttgtaacattacagcttagtcagctttg

ttcatatttaagtgttttcatttatttgtaatttccttgttataatttcg

tcttgtatagataagcaatatgtcatgcgtcactgaattagtatgaaggg

tcagctctttttgagaaaagcacagcattttgtagttgttttgcagtaat

taccatgtttaatcatctgtatgttatgatgtttttcagGTGGTATGGCC AAGAAAAGGACTATAATGTCCTAGTCATGGACCTGCTCGGCCCAAGTCTG

GAAGATCTCTTTAACTTCTGTTCgCGCAGATTCACAATGAAAACTGTCCT

AATGCTTGCAGATCAGgtaatgattggttaactcttccttttcgaataaa

ttgctctatggcagggatcacaaaacttgttcctggagatctggtgtcct

gcagattttagctccagccctgatcaaacagacctgaacaagctaatcaa

agtcttactaggtatatttgaaacacccaggcaggtctgttgaggcaagt

tggagctaaaccctgcagggcaccagacctcctggaacgagattgacccc

tgctctatggcataatgttaatctgcatgttttgctttaacagATGATCA

GCAGAATCGAGTATGTGCACACAAAAAACTTCATCCACAGAGATATCAAG

CCAGACAACTTTTTAATGGGTATTGGCCGTCACTGTAATAAGgtaaactt

tcatcgtttccttatttagttttataatgattgattt