exosome component 8

cDNA: Genbank AY648725

 

hi1011 is in the 1st intron, before the ATG

hi3709 is at the splice acceptor of the 3rd exon

 

cagtcaacatattgtctgcagagacgctgccagcagtttcccgttcagtt

aaagcacgcggagcgttaacaacagcctctctgtgacttctcgaggcggg

acatatatgaatggatgtcgtactaaattacggaataaatacttaaatct

ccattgttgaactttacttccagtcacagagaaacacctacgcggaagtc

gccttgacaaaccacatcatcacagccatgatcacagcgggcgaagaaag

cgcagattccgccgtgaccaactgaaatagcgccacacaccagagcggag

gacgcgaagttctccgcttttacgtcactgcagttATTCACGTGGTGCTT

CCAAACATCATGGCGGCTGGTTTTAAgtgagctacatgtgcaaattgttt

ttataatactattaatgatttatataggtgtctaaatagtgaggtgatga

tttcgctattttatttcagctgaatcatgttgtgttattgtttattt

hi1011 (3-5)

cagAACCGCAGAGCCTCTTGAATATCACCGGAGCTTTCTGgtgagagtta

atctttattcatatttagattgtggtagttataaagttctttttgttata

aattgttaatgttcagtgattttttaaaccctaatattcaatag

hi3709 (5-3)

AAAGAAAACTGTCGTCCAGATGGAAGGGAGTTGGGAGAGTTTAGACCCAC

GACGTTAAATATTAgtaagtctgggttgtttttatggagtacctctacca

aatacttgaccatattttgactgtattaaataatgacttttttatttaat

ggtttacac