60S ribosomal protein L13

cDNA: Genbank AY561516

 

hi1016 is in the 1st intron, before the ATG

 

ttgtcgaacttttaatgtgcctctgtccagtatccacgtgttgatttatc

gcaacaaaacccagcttcacacttcctgcacactggcgcttcgctcaacg

ctattggctgttttcttcacttcccataaaaccctgcgttgtcacttccT

TTTCCCTTTCAGCCATTTTCCGCTAAGGACGgtatgttcatttattccag

ctaaacatgtagtttatccgtattaatccttagttctaagttatcttgca

atcatttaagtcataaaacctgaatctggtcgtagttttatacccgttac

tggctgtattgttgaagttagacaatgttgagaaaaaataaacgagtagt

tttttgacaccgagcactgtggcggttttcaattcatgtttggatgtgta

tttccaacatgtagccgcttttacctaaccaattgctgtgttaatgcaga

gctaactaatacggcactttaaaagtgggctaaagcttattatctgcctt

tttaactcaagttggttgtattattagcgccgtggtccacaagcatgaca

gcgtccgagtaactgagccgacatgcagcatagtggcttgtggatttaag

gggtagttcacccaaatctggccatgttctcgacctttatactggtttga

aataaagtttctgtcttttgttgaactcaacattctgaggaaacctgtaa

ccattgacttccatagtatttgtttttcctactgttgaagtcagtggtta

hi (5-3)

cacgctttttagcctgttttccccgaatatcttgtgcagctgaaaaaaaa

ctcagttttttttaaccacttaattgagagcacaatttcattttgtggtg

aactatcacttgaatataagcaaatgtgtcataagtattcatgaagcaaa

ggttaaagttgtgtattgaggtaaagttggttgtatattctcaccgtcct

tcatttatttaaagctccctatgttatctactacactaaattgaatataa

gatccgaaatcatgtaaatatgacttgaaaacaatattagcactatttaa

ttgactttaaactttgttgtagtttgttattattggctgctaatatgact

tcactatttagagtttgcaaatgacattaaggagaaagtccgtgtgcaaa

taaaaacccaactgtaccttaagttgtcaacagtagtctgttgaagacca

tgtaggttgaaatgttataataaatcctttttcagagcttaagtgcagtg

tacggatttctttttttactgtatcgactgttgtcaacgtctggaatgga

tgaataggtttttaattgtcctacgaggagaatgggtgtggaatagtttt

aggactactttgataaaattttttggttcacttcaaatgttgactactgt

atatgtgaactgtttattttcgcattagGAGTGAACAACCATGGCTCCCA

GCCGGAATGGCATGATTTTGAACCCTCACTTTCATAAAGACTGGCAGAAG

AGAGTGCGCACCTGGTTCAACCAGCCTGCCAGAAAGATCCGCAGgtaata

agtgtgtccacacatgtgttga