nucleolar complex associated 3 homolog

cDNA: Genbank AY648726

 

hi1019 and hi3783 are both in the 1st intron

 

ttatattatattatattatatttttttatattatcaaggagaaagtctca

atgtgtgaatctaaagtcaactttacctcagtattaataccttttgtagg

tattcgtttctccaggccacaagatggcgcgtgaaggcggtgtgtgcggg

gttcatctagttttctccattattttacttcctGTCCATGTGGTGCGTGT

TTGAAGAGTGGATTCATGCACTCTTCAGTTTTAGGATTAAACTGAATCAC

ACGTTTGAATTATTGTCGACCTTAAGTCAAATCATCGCTCAAAATGGGCC

CGgtaagtcattttttgattgtcacaaaaaaaaaaaaaacgcgtgtgtgt

atttattaaaacttcagctgctgttggtcatgtttctcagtgaactgctg

cttcattatcctaaattgtgtttttaagaggaatattcgagaccgaatag

tctttatttcaatatattgtattagtcaaaacgttgccgagtcacatgta

atgaaataataacgtaaaac

hi3783 (5-3)

cttccgtgtcatattgtttaacagttactggtgtaatccatacagcatca

aaccacagtattgtcatttatttcatgtcgaaaaacattttttatggtta

ttttaatcaacaaaagtggtgtaataatata

hi1019 (5-3)

tatatatatatatatatatatatatatatatatatatatatatatatata

tatatatatacacacacacacatacatatatacatgtatatatatatata

tctatgggccatttactgtaacagaggttggttttatatttgcacattcg

tttattcagtctctatgttgtttaccattttactttgaatattcgatcag

aattagcatgcaagtatgactataaaaaattaacactgtttaattgactg

taaacaatgctgtactttgataatcattggctgttaatattatttcccta

tatataatttgcaaagaatactttttctgaaactatattattaaggagaa

tgtctgaatatccgaatatacaaccaactttacctctgtgtttactagag

ttggttttatattcgaacgggatacatcttaatgtacaaactaattaaag

ctgtttcattcttttattgctctgttgctcgaataaaaacactttcatca

ttgtcctgattcatatatgaagaagttacggcttatttatatttgttgtg

agcaattccatgcaaatgtcaaccttgccatgaaaaaaaagaagtttttt

tgtgtaggctttagtttaacagtacttaaaaaatactctaaatgtctctg

tcaaggttttaaaaccaatgtaaaccaataacccaagtcacacaagtcca

atttcacatctgccacatcaataacaaagctttttgtcaaaatcaatagt

ttttgttctatagtgagccgaatatcattcttttgattagcattatttct

tatagattgtgcagtttaattcactgaatttttacaaagtttgttatata

cagtgctcagcataataggagtacaccccattttaaaaaattattttttt

tcttcttttctcagtgaatttaggcgatgtattttggtgcatttaaacaa

aacatatttattaaacatatgtattaaaataatgttttagtgaccaaaca

ttttcattagaaaatgaaagttaatgcaattaaattcaagctaaatattg

caaaattaaattacaacctacaaaatttcaacttaatttttccttttttt

tttttttttttttgcttctcttgacttttcctcttttaaaaatttagatt

taatatttttctataacaaatttgtgtgtactagtttttggaccgttatc

gtaagttttttgtaaggttttgttagataagctccagatttggcttcagt

actgactaatctaatgtatatgcacacaaaatattgtagagcttcctatt

caaatccgattttttgtttttgtttttttggtcacatccataatgttgtt

aatgtgtacatattgttataatgttaacaaatactttctatgtgaattaa

tggtttaagattttactgcaaatgccacactggaattgctcatgtacatt

agcatccatgattcatctgtgtgttaatctgtattttactcaagGCTTCT

AAAAGAAACAAGAAAAAGAGGCCTAGCTTCAGAAAGTTACTGAAAACCAG

TAACCTGAAGCTAGAAAACAAACTGAAGAATCGGCAGTTTAAGCAACAGA

GTTCGGCTAAAAAACAACGCAAAGAGCAGAGGAAACTCCACAAGGCCATT

TCTGATGTTTCCCATCAGACCCTCAAACCCCTGGAGCGCTACAAGAAGAG

ACCCGgtgagccaacattggtttctgggttgttttgcatgagctcagtgc

tgttggagttttgtaatgttgatgttggattacagAGGATGAAGAGGAGG

AGGAAGAGTTCCTGGAGTCTCTGCCCACAGATATGATGGATGAAGATGAT

CTGGAACACATCAGAGCCATCGCACAGAAAGCCTCTTTTCTGACCCGCGA

CCTCTCTTCATGgtaagctcagagttaaacacgtgcagtacgcaaatcac

tagatatttctttcttaacagactcttatg