40S ribosomal protein S18

cDNA: Genbank BC062289

 

hi1026 is in the 3rd intron

 

ttcctttttgcgcggaacCAGCGATCAAGATGgtgagtgcgaaatggtac

tctcaaagcttaagttgaaatcacgcatcatcggtcttatttatctgtgt

acagttgtaccgataaaatattgtatgtcctttatacacgtttaactatt

tttaatgaatatttcagctattaagtaggatttaacgttttaaagagtta

ccgatatctcctaccctgttgaccgcgccgcttcaaaaagacaccatact

agtgtttttaaggatcatgctaaaaattaagcatctgtattgtgtcacaa

atttatgtatgaatttttcccctaaatatttaaagtgtactatgtaattg

cataaggtcagtatggagccgttacaataatgtgctgaaatgcttgccca

aaattcattagaagaggataaaggagctagttgttctgtatactattacc

ttgtggtgtcatgcatgctgactttgttatttttattttcagTCCCTCGT

CATCCCAGAGAAGTTTCAGCACATCCTTCGTGTCCTCAACACGAACATTG

ATGGAAGACGTAAAATCGCATTTGCCATCACCGCTATTAAGgtgaactat

tttaactagatcaattttgttctgtatgttaatatgatttaagcttttaa

tattgtaatctacttccgttaatagGGTGTTGGAAGGCGATATGCCCATG

TGGTTCTGAGGAAAGCTGATATTGATTTAAATAAGAGGGCTGGAGAACTC

ACTGAGGATGAGgtgggtttgtaaatgtttaaatggacatt

hi1026 (3-5)

gaactgtttcttacaacacagatttcatgtcagatgacacaattttatta

agttctaaagcagtttatattccacccagaaagattttttgataaacgca

agtggaaaaataagtgaaaaattttattattctttaaggaatttttaaag

gtctaaaatgtttaatgattatggttttattgaatagGTTGAGAGGGTGG

TGACTATTATGCAGAACCCTCGCCAGTACAAAATCCCAGACTGGTTCCTG

AACAGACAGAAGGACATAAAAGATGGGAAATACAGCCAGgtatgattgtc

tattaccattttaaaagtttatcaagcatgtctagcactgttt