G10 (BUD31 homolog)

cDNA: Genbank AY648727

 

hi1034a is in the 5' UTR

 

taaccgctcgtggtatttatcggctcgggtgatatacagttaatgacacc

aacacaaaactccacgattatgtaggtacagtcatcgattagcatttagc

cagcgggtccatgttcttatatttacattcaggcacacgatcagacacct

agcctgatgcaatatggtgtactacagaataacatcacagctttaccata

ataaaactattgctgatatttgagatactcagtaattcataacaaatgat

attagcatttggataagtcgaaatataacgcggacaacaactgtggttcg

tgtttatttgttaaagaacaaagacagcttgttgacgtaactttggtgta

atgaaatgctgaaaggacctttggtgtgacgccacccctctGCGCCGGAG

ATCGGGGATGCTCTAGAGCAGCAGCTCGTTTTTTGCTAAATAGCGTCGAG

TTGATTATATATTCCCAAAATAATA

hi1034a (5-3)

TAATGCCGAAAGTAAAAAGGAGTAGAAAACCTCCTCCAGATGGGTGGGAG

CTCATAGAACCGACTCTCGATGAGCTGGACCAGAAAATGCGCGAAGgttt

gttttacagtcgacgagcttgtcagaatgctagctaacttaacgctaagg

gttgtttacttgatattgattcttaaat