40S ribosomal protein S7

cDNA: Genbank AY561508

 

hi1034b is in the 1st intron, before the ATG

 

tcgaaataaaaagacctgctaaactgattatgaacaggcgctctctgccc

tcagcagttcccgtcatgcaacagggcaaCGCGCTTTTACCGGCCTCTCG

CGAGAGTACGGCCTCTTCCCAGGCCGTCGTTGAAAGAGgtgagtctactg

aatgtgcccagctatgtggatttaacacaaaaatgtctaaaataagtaac

attcgtctatttgtttaagctttaaatgatgtttacacagggatgcgtta

gatgcgcctgtgttagaggatggatggctgtattagacatagaaatgtac

acatttaggatgtgctagcagacgtgtatgtactacagtattgccatggc

ccatgtgctgctcttggatggcttggacatgctaacaagtaaaataatgt

atacgtaaggtctaaatgtataactgttgcgcgcctgtaatgtattttag

tgattctgcattagtaagtaaatgctagcagcatgctaggaacacttgga

gttagccgaga

hi (5-3)

ctgcttaacgacagcttttgaattactgaggacagatcaagataggatag

ttaagtcggaggttaatgttcggttttatctcttttgacagttgtttttt

ttttttgcaaatacctaataaaaccgtttttaattgtttttttttttttt

taatagctaaggaaggtcattttgatttaagtaacatgatggagagtttc

actttggtgaacttttgcttcaacttaattactgtgactctttgtcattc

taatcagtgtatttgtgtgtttcagACACAGGCCATGTTCAGTACCAGCG

CGAAAATAGTGAAGCCGAATGGCGAAAAGCCAGATGAGTTTGAGTCTGGC

ATTTCCCAGgtatcatttaccagaatctccagtctttcgtgtgtgatcta

caagcg