erine/threonine kinase a

cDNA: Genbank NM_212566

 

hi3986 is in the 1st intron

hi1045 is in the 5th exon

 

 

GGGGAACACTGGATTAAACAGCCGCCATGCAGgtgaataatacagtcttt

aatcgtttaatttcggtataagcttacatatctgtgttggttatgattta

ttagtggcgcgcagtggttaatctgtgatttaactgtcattgtccgagta

cacgagtcgtgtcacagcagttaaccatgatttactgcaaaattaattaa

aagtaaacggggtggttgtcgttaaagcacgctgatcagcaatcagtata

gttctgctccactaattctagtttaattatgatatttgtactaaagcagt

ggtcgactaactggttaaaggctgtcaatacaaaaacaaacatggcgtcc

acgctttaccgcaataaaatacggggaatgtggtgt

hi3986 (3-5)

ttacatgtctaatgactgttctgtttctttaagtgtgtgttctgatcgat

gatgatgtttttttgtttttcatcagAATAAAGAAAACCGGGAACCCAAA

GTTCAACAAACACCGgtaacgttacagatcgtgtgtgtgtatgtgtttgt

ataacttaacgttaactgtcgtttttgtcggtgtgatcattgtgtttgtc

agtgtgtttctgtatagctaacgtgtgtttgtgtgtgtgatatttgtctg

tcagtgtgtgtttctgtcttgttttaaatagaaaatgtgcagtgtcccca

caattcacgaaaagaaaccagtgtgtgtctgtctggtcattgtgtgtgtg

tgtgtgtgtggtgttttgtatatctgatgtgtgtctgtgtgtgtgtgtgt

gtgtttcagTCTGCTGGTGTGGGTCCGCTCAGAGTTGAGATGAATCCAG

ACACACACGCAGTCTCAGgtaaaacactttattgatttgtttttacccca

gctgaagtgtagacgtgccgtgacggttgtggtctttttcagGTCCTGGC

AGAGTTCCTGTCAAGTCAAACTCCAAgtgagttgaacatatatttgttca

ttaatatcagtgtttgcgtggctgttgagtgtgtgtgggcttttaatata

attttaacctggaaaaccgtggaggcacatttatacacacgctgtactgg

tatggttttgttcatgtgtgtgtgtgtgtgtgtgtgtgatgtctgcggtt

gtcttcccccagAGTGCTGTCCATCGATGACTTTGACATTGGCCGTCCTC

TGGGAAAGGGTAAATTCGGGAACGTGTATCTGGCGCGCGAGCGGAAGCTG

AAGGTGGTGATCGCGCTGAAGGTGCTCTTCA

approx hi1045 (3-5)

AGTCTCAGATGGTAAAAGAGGGAGTGGAGCATCAGCTGCGCAGGGAGATC

GAGATACAGTCACACCTCAGgtccgtgtgtgtgtgtgtttctgatgctcc

acactggcttctgtttactgatccaaacctcttaatgatgaggttaaaag

aatagtttgtacaaacactgaagctaaagctataccgatgcgaccaatag

cagtatgaagagttcagacaaatgttgtcatgatcaaatcggtgtatatg

taagtgaacatgcctagtttactctttaggcaacctcttttgttttatat

ggcgtgcgtcttgattataattttggttcattttatttgtaagttttcca

tgactgttttatttgttaatgaacatgtttttttatcgtagttttcgtgt

tgtttactaaaattgtgtgtgtatgaacagGCATCCCAACATCCTTCGCT

TCTACAACTACTTCCATGACGACACCCGTGTGTTTCTGATTTTGGAGTAT

GCGCCGCGTGGTGAGATGTACAAAGAGCTTCAGCGATACGGACACTTTGA

CGATCAGCGCACTGCTACTgtgagtttcacacacgcctctactgttcatt

tatggctcatttcccctgagtggtacggtacgctcttatggccgtttcca

ctgtcaaaaggtgtactgaatcctaccactttttcggcaccaaaaggtgg

agctaaacgcgcagctgagcgctattggtttacagagatgcgtcattcac

tttaaacaagcctgagtgaaaacaaaggatccgcca