MAK16-like RNA binding protein

cDNA: Genbank AY099519

 

hi3960 is in the 5' UTR

hi1055a is in the 1st intron

 

caacccatttgtatgcaagctcccgtcaaatcccaacgaagaagaagacc

ttgcgtggtggagtagttcatgtggtgttaataTGGCTGCCATCTGTAAC

TTCCATGTGCTGTTTTATTATATCACAAAATAACTGC

hi3960 (5-3)

TCTCATCATTTTTCTTATCCGTAAAGTTAATTTCATTGTATTGGATTAAC

ACTGACATTTACGTACAGAGAGCCGGTTGTTCAAAGAAGCCGTCAGAATG

CAACACGACGACgtaagtattgttgtaagactgatggtagaaatgctttt

cattttatctgaaattaataacgttatgggctctaggaaaattttagttt

aaaaagaaatctaacacaaattactatgccataatttgggggttgttttt

gttttagatttaactaaacttgcaatcgacaacgtcttaaagtagacctg

ttttcgcaccagttagtattttattcgttca

hi1055a (5-3)

ggtgaagttggtattgtattcgcgcattcgggctataatatagttttatt

aaggtatttttggccaattctaaacagtgttatcatataatcagtcaggt

actatcaaagtatattacagtcagttaaacagtgctaatgttgttttgaa

gtcatagtagcatgctctatcagaccaaatattcaaaatagcttggtaaa

caatgtaggaaccatgtaacaaatctaactatttttaaataaacgaatat

aaaaccaataataatccttcacatgtaatattttgttttttaaagGTTAT

ATGGGACCTTATCGGCAATAAGAGTTTTTGTTCCTATAAAGTTAAgtaag

tatatgaaatttgggccactacatgt