RuvB-like 1

cDNA: Genbank NM_173835

 

hi1055b and hi1944 are both in the 1st intron

 

 

tttgcggacggtacttcctcaaaTCGCCTTGGTTACCCTCATGGAAACGC

GGGTCTCTTGTGTTTGATTTTAACGGCCTCTCGTGAGACAGGCGTGTGGT

TGTTTTATTCACGCACAGCGCGTTCGATTAATTATTAAGAAACATGAAGA

TCGAAGAAGTAAAAAGCACAACCAAGACGCAGCGCATCGCTTCTCATAGC

CATGTGAAGGGCCTCGGTCTGGATGAGGCTGGTAATGCTAAACAGTCCGC

GTCCGGGCTAGTGGGACAAGAAAGCGCCAGAGAGgtaactctagctaaag

accaatttccgtgtttatttcattaattacgaaaagcaaacattttaatt

tgataacctc

hi1944 (3-5)

gaatgatttgtatgtacctggctatatgtgaagaatgaatacaaaacttc

taattcatttgcttgtgtcaagagctggatacaattgattgtaaatacga

taatttcatatacattcataggctaagttatatatgaagagttcagatgc

taaaacctctaagtaccgtctgaaacttccattaaagctgagcattttta

tctcagcattctatattgattgttgagttatttcactttaaagatcatta

aatgaacatactctttaattattctttaatttgtaaatactaaacctact

aacaggagcctgataaaaatgtttattttagaagaacatttcagacggct

tttagaagtttttgcatctgaccatatatatatatatatatatggaatat

tgtaatcacactttttgaacaaaataatgttttcatgtatgtggcatttt

ctggcctgtagtttagcaaactaatcctgg

hi1055b (3-5)

gacataaacatctagaaaattcttgcatatttgttagGCTTGTGGCATCA

TCACTGAGCTGATTCGTTCCAAAAAGATGGCTGGCAGAGCCATTTTGCTA

GCCGGACCGCCTGGAACAGGCAAGgtaagggtagactggttttatttaca

ctgcactgtataattaaaatggacataaaatagtttcagagctgttgttt

aagatagtatttatagtctgcccatttgatttctatccaccacagACTGC

TCTAGCACTGGCCATGGCACAGGAATTAGGAAATAAAGTGCCATTCTGTC

CTATGGTGGGCAGCGAAGTTTATTCATCAGAAATCAAGAAGACCGAAGTG

CTGATGGAGAACTTCAGAAGAGCCATAGgtgagctctcacactattatcc

accataacctgtcaaaaaatcacagaggaaaattggttttatattc