Sec61 alpha form A

cDNA: Genbank AY029527

 

hi1058 and hi2839b are both in the 1st intron

 

cgttcatctgacgtgtagtagagtcggtgtagtgttgacgtgtctctaaa

gcgctttcctcccttcgctcctctcgcttctctcTTTCTCTCTCACCCGG

GCGGCGGAGCGCACCGGTAGCGCTAGTTATCCGTTTACAACTCACTGGGA

CTCCAGACAGAGACCGTGATTTCAGGGGACCGTCATCATGGCGAgtgagt

gcagagttttcgagcgtttatcctgtgtttggtagagttgttcaatgtaa

atctgctgtcaattcacactcgagttctgttagcactgttagcatgctag

ccagagagctttctttgactaaacctgagagaagg

hi1058 (5-3)

gtttcagattctatactattcacatttgtagagcagtcaactggaatgcg

tttaaatgtttctgtggtttatttgtttgattcaccagttgttattcgtg

tgtgggggtacgtttacgttgcttttctggtggctaatggttgaatggct

tcgagcagctagcattagcttgtaagctactttttaacacgtctgcttga

tctttttttattctgcaaaccgtcaacgaggccttcagttatttgaaata

aggcacaatactgtgaaatagccttatttgttgttatatcggactgcaag

accggagggaagttgtcaaagattccagaggctaacgttataggtttcag

gttaattgattgcacttaacgttaacttgtgtgtttaacatgaaaacata

ctaaacaaaaacagagaaattgataagttgttaggtctgatgtattataa

gattttgtattgtaagaaatgttgggaaaatgacttttttattcatcagt

ttaatgatgacgacgctttagattggactgttgttgtccttatagttcga

caaggattttgggaaagtgagactgtttatcagttgttgagtgatctctg

tatacattttcacctcatgttggtgaattgcagtaatatggttcaacata

tgttatgttgcatt

hi2839b (3-5)

tagtgaaattgtaagtagtttaattttctgtcatcaaataatcttgtgag

atttctcatgtttttgtcatttccagTTAAGTTCTTGGAGGTAATAAAAC

CGTTTTGTGCGGTTTTGCCTGAAATCCAGAAACCAGAACGAAAGgtaaaa

tattgcacacagcgtgtatccatttttatttattattataactttatgta

ataaacagcatttctaactttaaacacttttttgtttcagATCCAATTCA

GAGAAAAGGTGCTATGGACTGCCATCACATTGTTCATCTTTCTTGTTTGC

TGTCAGgtaagttgtgtttttcagagtatgaataaatacactacacctat

gcctttgttctccagctacttcagtgtaaagtcaagattttagttgagag

ctgatgactgtactgtttctcttggtcttagATCCCACTGTTTGGGATCA

TGTCTTCAGACTCAGCAGATCCATTCTACTGGATGAGAGTCATCTTGGCT

TCCAACAGAGgtaagacactgtactcactcagtgtaattcacaattaatg

aggtgctatgttttattgaggtaaagtttgctttatattcccacattctc

tttaataacataagttatattagcagtcagtgactatcaaagaacagcag

tgttcagtcaattaaaataaatggtgctcatgttgttttgaa