neurogenin 1

cDNA: Genbank AF036149

 

hi1059 is in the 3' UTR

 

tgcatgcaggacagacagcaacagctccgctcgcgtggccggacagttct

cctgctctctgattggccagcggtgattacaggcacgcttcagagggcga

acaaacaacaggcataaattatgctaatgagatggtcgtgcggcacgggg

cagacctgatgcaaaccattcattcatccttcacaaaaatgccaaagcga

ggggggtatgtccattgtcccatcagggtatataaggtaggtgaggccag

tcgtgtgccaagctcacaagctcacacgagCTGATTGAGGGTTAAGAGCA

AGACAGACGCGTGCCATTATCTTCAACACAAACTATCTGCAGGATTCTGC

AAAACCTCAAGCATCTCCCAGCCCACCAATAAGgtgcgtattgcgtcacg

cagataacttgaaaggactttgcacgactgatgttgttttttgtttcttt

tctggcgtattcctaacctgattttgtaaatttctccagGTTATCAACAA

TGGAGATCGTATACTCCGATATGGAAACCTCAAGCTGTGACTACTCCTTT

TCGCACACGGATGATGAAGACTCGCGCAGCAGCCTCCACCCCGCGTCCCC

CGCGTCCTCCTGCGGAAAACCACCTGCGTCTCCAGCCGGGCTCCAGCAGA

AGAAAAGGCGCAGGGGGCGCGCGAGGAACGAAACCACTGTGCACGTCGTG

AAGAAGAACCGCAGGCTGAAGGCCAACGACCGCGAGAGGAACAGGATGCA

CAACCTTAACGACGCATTGGATGCTTTGAGAAGCGTCCTGCCTGCGTTTC

CTGACGACACAAAGCTGACCAAAATTGAGACTCTGCGCTTCGCTCACAAC

TACATCTGGGCACTTTCGGAGACCATCCGGATCGCAGACCAGAAGCAGGG

CAAGTCAAGAGACGGTCCGCTGCTGCTCCCCGGACTAAGCTGCATGGCAG

ATGCACCCAGCCCCGTCAGTGACTCTTGCTCCTGGCCGTCGAGGGCATCC

TCGTCGTCTTCATCACCGTCTTACTGCAACTCAGACCCGGGCAGCCCCGC

AGCCATGGACGATTTTGGATACTTGCAAACCGACGTAGTGTACAGCTACC

GCAACTTCGTGCCTAGCATCTATTAATGTGACTTTAAGCGTTCTCATGTC

GGTATAGAATCTCCAGAAGTATGTAGTAGTGTAAGACCACTGTTACTTTT

CTATTAGAACCAAGAGCACAACGTTAGGTATTCACTGTTTGCCTTAATGA

CAGTCTGCAAATGAGAATGTTTTATTTTTGTACGTTTTGATATTGATGTT

GATGTTGATGCTTTTTTCCAATACCTTTGCACTTTTTGCATTCCTTGGAG

CGTGACCAGAACCCCGTTAGAGAAAATTATAATTTAAAAAGCAAGGCAGA

TTGGCCTTTGCTGTCCAAGGTGAAAAGTCAATATTACAATTTGTAGAGCG

ATAAAGCTGAAAAACGAGCGTGAAAAATCAGTTTCAACGCTGTGACAATA

GACTGAAAGGACAAGACAAAGATCTGGCCTTATGCATTAT

approx hi1059 (5-3)

GTATTTTGACCCGAAGAAACCCTCATCTGTCCGACTGATCCGTACAGTTA

ACCAGCTCTCATGACGGCTTTCCCACCACTTTTCTTTTTTTATTTATTCA

ACCTGTTGCTTCTTTATGCTATTGTATTTTTATTGTATATAAAGAGATTT

ATTCTATTATGTATTTACCTCAGAATATAAATCTGGTGCAAACATGTTTG

TACGAATAAATATACGTTT