60S ribosomal protein L7

cDNA: Genbank AY561515

 

hi1061 is in the 1st intron

 

tcacgcgtgtgtccgcctgttatgcaaagtaaccaaaacttctgcgtcaa

atgcgtgtacacctttacgaggctgagcgcatatttacaggatttatatt

aattattaaatattgacgtgagcagaaaaatgcttaatagcaaaataact

agaatataatgttttaaaatgcaggcatatacttgaagacctcgtatttt

accggaagtaagaaggacctgccttataagaccttaccgcgcatgcgtag

aagcCTCTTTTACTGTAGGGATAATGGCGGGTGAAACgtaagttgataac

cgtgcggtgaaatcttcttccatccgtttagttattgctctttttatagt

tataagaaacaaaatgagcatcgcatatatgcttaacgcttaagatgtga

aaattgccaagtatgcggtgtgattaatcaatacatttcgcatgattgtc

cgtgtagcccatcggctgattcggtcagcaacgtgtgaagcaacagttta

tgaaattacattaaaatatgtccagatcagcagttctgtaggagaaaaat

gccaaagtgtggcgcgttgttacaaaatactctagtatattcaatattta

tcaactgtcattagctagctgctaacttgaaggcatgatgctaccgcgct

agcatattttaataaatatatgcttaagtctaatgttcggctgattaact

gtaccgtgtagattaagcaaaccatatttatgctgtttggtctttggcaa

ggttgtgttaaatactggttttctgacactatacataatggtcgtgcagg

ttacagtcagtatctgacttgtatgctgtttaaatattagtgtggtgtag

tttatatatttactt

hi1061 (5-3)

cttatttttgttacaactgtgacgatatccctgtctgtatgtcaaaggtg

cttactaggaaatgacatgtgctgttattcttatttagGAAGAAGAAGAT

TCCCTCAGTCCCAGAAAGCCTCTTGAAGAGGCGACAGCGGTTCGCTGCCA

TCAGGGCCGTACGTCTGAAGAAAGCGAAGGCTGACAAGAAGgttggtggt

ttagtgttatccattttatttattcttttaatttataaacgaaggctcat

tttttcaaaagtattaatgtggccaaatctgctctgtcccttagGCCAGC

AAAGTCACCAGGAAGCTCATCTTCAAGAGAGCTGAAGCTTACCACAAGGA

GTACAAGCAGCTGTACAGGCGTGAAATCCGCATGAGCAGGATGGCTCGTA

AGGCTGGAAACTATTACGTCCCGGCTGAGCCCAAACTGGCTTTTGTCATC

AGGATCAGAGGgtaaacttttga