BRG1/brm-associated factor 53A

cDNA: Genbank AY099520

 

hi1072 is in the 2nd exon

 

tccgagacaaagatgtctgattCGTTTCCTTTGTTGTGATATCGAAAAAA

ACGTAGTCTTACTTAAAATCTCAGCTTCTGGATTAAGAAATCAAGCAGTT

GTCGTCTGTCGGTATTGATCAGCCGTAAAAATGAGTGGCGGAGTCTACGG

AGGAGgtaagtgcggttttggagggagaatcaaatgaatggatgcgccac

gtttaagagctcgctagccttcaaactagcatgacatggttctgttatta

tttagtggaaacaaaacagagcccatgtttaagttgttatcttgtgtata

atgcagaatacaccatatattgctagctgtgtgttgtaaatataaataat

atgaagtaagagttttgtattttaacgaactcgcgtgcacgattgccagt

ttattgtatagaaacattaacttgtgttaatactgtaacctcatcagttt

ttttttcatcttttcacagATGAAGTTGGAGCTCTTGTCTTTGATAT

hi1072 (5-3)

GGGCTCGTATTCAGTGAGAGCTGGATATGCAGGAGAGGATTGTCCCAAGg

tatgagcagtgagatgaaaacatgtattgcaggtgaagctgaaaatgtat

ttgtttacagcagaaataagatttgttttgtggatttgtagGCTGATTTT

CCTACTGTGATTGGTGTGACTCTGGACCGGGAAGATGGCAGTACACCGAT

GGAGACAGATGGGGAGAAAGGAAAGCAAAGCGGAACCACCTACTTCATTG

ACACCAACCAGCTCAGGGTGCCTAGAGAAAGCATGGAGGTCATGTCACCT

CTCAAAAATGGGATGAgtaagttttatttgtgtcctgtttgttttttttc