dpy-19-like 1, like (KIAA0877-like)

cDNA: Genbank AY648728

 

hi2727 is in the 1st intron

hi1073 is in the 2nd intron

 

gcttcattcaacAGATCAGCGGTGAAACTGAGCAGAGCCACAGATGAGAG

GCGTCTGCGAGAGCCAAACTACTGATTTAACGCTCATCCGCGCCCCTGCT

GCCGTCCTGCTACACAGAAATATGAAAACATGGTAGTAAAAACCAGAAAA

CCAAGTGCCAAGGAGCAGAGCAGCGAGAAAGACAGGAGTCAATCCGTGTC

GGGGAAATGCAGGCGCGGAAAAGATGGGAAAGGCTCGGCTTTTCAGAGTA

AAAACGGACTCTTTGCTGGGTTTATTAAAAACAGACTGGGTTTGAGCCCC

TCCGCTTTTGTAAGAGGAATAACAGTGCTGATTCTCGgtaagaatgtctg

ctttagctgctaggtagctaacggttttttggttagcatctagcatgctt

tcagtgtttataggagctcggattgtaaacaaagttgtgcaaaacccata

tttcatttgtttggtattagattaaattgataaatgtaattaatgacctg

atttaattaataaacaataaattagaggtttaaaactgtggttattgggc

aatgctcggatgtttattgtaagtttgttagcaatcagtcaaaattacat

catttcactacaggtatttgccattcatatactgacagttcctaagattt

attcttgtcaactacttacagttttaagtataaaaatta

hi2727 (5-3)

tttatcagaatctttcatctgctttaaaagtacagcttgttcctcttcaa

ttgtgttttggttggtcagataaaagtcccccaaatgtggccacgtagca

atctgactgacctgcaaataattctctcaatatgatctgtttctctttat

agCTGTTGTTGCAGGTTTTTTTCATTGgtaagtagcttttaatctttaaa

gtatgcagatacctttcttcttgtgacagaataaatgaagtcttgtatc

hi1073 (3-5)

tttcagGTATCATCTCTCACATCTGTTTGAAAATGACAGACATTTTTCAC

ACATGTCTACTTTAGAGAAGGAAATGGCTTTCCGAACAGAGATGgtaatt

ctgctttatttttaatgcgtatatatatatatgtattaaacaaatataca

ctcactggtcacttcattggatacaccttactagtaccaggttggactct

cttttgccctaa