DEAD box polypeptide 27

cDNA: Genbank AY648729

 

hi1086a is in the 1st intron

 

tcattatcgttatacattttatgaaacatccgattttacgattttcgtcc

tccccacctgtaggcgtcactaacgcaactatcaaccacgaggcgcgtga

gagtgacgcacttctgctttttcagcgacacACGTGTGTTTACGAACATG

CAGCACCGATAGTGTGTCAATGTTTGTGGTTTATTAAACTGTACGATCAG

ATTTGTTTTTTATACATACACATGTAGGTAAAGATATAGACTCTGCACAC

TATCAACTGTATCATAACTTTAACCAGCCTGTAAAGTTTGTTAAGGCGCC

TCAGCGCAGTCGTTTTCAGACATGGATCTGATCAGAACTATTGATGATGA

TGAAGAGGTCCCAGAAGAGCCGGATTCAGGATCTGATGATGAAGCTgtga

gttcaacta

approx hi1086a (5-3)

ctctttacatactgtcagaaactacttaatagtgttttcttagacatgta

ccacggtaaaactgcgccttctgtccataatacttatgttttgtacttca

atagtcgattatctgcatatatactgtagtaatacagtgctttatacatg

tgcgtcttgctaaaacgatgctattttgtgatataccagggtaatattgg

tgtttgagcctcatgttatagtaataccatgatattgggtgagtgtaatt

gtaatgctatggtatctggatgtattaatcaacatactatggtaataaca

agtcattttagggtcagtttatgttgtaaaaagtggaatagcttcatgta

ttattgaaatattatatggtcttatgatcataccactttctgatagctgt

ttgaccctcatgttatagtaataccatgatattgggtgactatacataca

catacatggatttataaatgcattaagagcagttgttgtgtattttgtgt

gcgtttagGATCAGCCCATCGTGTTGAAGAGTAAAGAGAAGCAGGCTCTG

AAGGCCCGCGGCTCAGGACACTTCAATGCAGACTTTGATTTTGGCGAGCG

GGATGGCCTGTACAGCGCTGACTGGGCCATGGCGGATGTGATGGCGCAGC

TGAAGAAGAGGgtctgtcagattctcgcacagcacacacacattcaacac

act