SMC1 structural maintenance of chromosomes 1-like

cDNA: Genbank AY648730

 

hi1113a is in the 5' UTR

hi2068 and 2327 are both in the 1st intron

hi3821 is in the 16th exon (~3/4 of the way into the gene)

 

caagtcgccaaaaaactaagaagaggaagacagtgtccacacgtaggagt

tctcgcgagatagttggtttaacgatttgaattgaaatctcgcgatgagt

GTTGTGTTTATGGAACAGTTAGCCCGCGCTGCAGGATTCTGCTTCCGCTT

ATTTTTGGTTTGGCTACGACTGATAACTTG

approx hi1113a (3-5)

AGTGTATTATAATGGTTTAGTTTAAATTTTGTTCTGCTGTGGAGCCCGGT

TATTTTAGTGAAATATTTGTTAGTGTTTGTCTAAATTTGACGTGTCTGAG

TTATTACTTTGTTCTCATTGTTCGTGCTAGCAATAGACACTCAGGCCGTA

TTCAGACAGTTCACGTTTTATTATTTGTATAATCAAAGTCCTTGAAGTAA

GTGGTTCAGCATGGGCTACTTAAAGTTGATAGAAATCGAAAACTTTAAGT

CTTACAAAGGTAGACAGATAATCGGGCCTTTCCACAAGTTTACTGCCATT

ATTGGGCCGAACGGATCGGgtaagtgtccttt

hi2068 (5-3)

catataattttaacctcacacctttaaataaacaccgaagtttaagtata

ag

hi2327 (5-3)

tacgctctaaaacatttttaaaagtacctgcgcattcagtaatgctcact

ataaaactttaaaataaaggtcagttgagtgaatac

(~12 kb to next exon)

 

much later in gene

 

actgtctgatagCTTAGAATTTGAGACTCAAAAAACACGTCTGGCAATAC

AGCTGGATTATGAGAAAAACCAGCTGAAGGAAGACCAAGAGAAGGTGGTC

ATGT

hi3821 (3-5)

GGGAACAGACGGTCAAGAAAGATGAAAATGAGATTGAAAAGCTTAAGAAG

gtagaaaacattcagatgatctcttgatgtttgagtctggaaaattttct

gattttagtggttttgtttaatatttttaacagGAAGAGCAGAGGAATAT

GAAGATAATTGATGAGACCATGGCACAATTGCAGGATCTGAAAAACCAGC

ACTTGACTAAGAAATCTGAGGTTAATGATAAAAACCATGAAATGGAGGAG

ATCCGCAAGAAACTAGGGGGTGCCAACAAgtaggatcaacatgtgattta

cttcagacatgctccgagattttcaagaaattaagtatgatgtaat