laminin beta 1

cDNA: Genbank AF468049

 

hi1113b, hi1297, hi3181 are all in the 1st intron

 

agcagcagcagcagagtctgcagagatcagattcagctctgcagtttccc

cacacaaaatcaggattactgcactcccgctgaagaaagaaactggaaat

ATGCTGTTACAACTCGCAGCCCTTTCAAgtaagtttcattttagctgtgt

Tgaagaaatgtttcttttgcaattcatttaagctactgaagtagaactag

Ttttttatttttttatttttttttagtttatttgtttacagggtcagtgc

acatacattactgtaaaatgtgccaga

approx hi3181 (3-5)

attagccaagaatggctatttttcatccgtagaccctttacagaatgtta

aaaagtcacacctaaaatagaagcacaacattaaacattaaatacacttt

cataagaaatacagttaaaaaagtaaagaaaagaaaaaaagaaaggaaaa

aaaaaagaacagactgatggg

hi1113b (3-5)

agcagaggacaaaaagccaaagacaacagtacaaatgtgtcaataacaca

gtactaatgctgacaatgctgatttgtcaataaccaatttctaacatgag

actgaaaagaacgaaaagtgcatgatcttctaattgttggtgggatggag

ttccattccctagcagctctcactgaaaatacagattgactgaatttgc

hi1297 (3-5)

tttttttgagaggaataatgcagtctcctctgtcacctcctctagtagtt

cggtgagcagtcgttctaatatttataaactgatttaatggtgaagtcgg

gttatgtaaagtcttaaacattaaacagatatgtacatatgtaattaaat

tttcccaactaagcaggttgtatttctttaatattaaacagtggtgaata

ttgaactgatttcttatcaagggtttgaattgtatttgtagttgtgtcat

aacagtaaaatggtatttaaaattttaccatttttaatttaataaaaata

gtatttatattgaattttttttaatattaatagtcatttatgttgatatc

ttttttttttttgcaaataaatgttctgaatgtcgatattttatttaaaa

tattgaggacacattatcagtagtttattaaataaaacacacattaacat

tttattttaaagcatactcattaatggcaaatcctgaaaaatgagaagct

aaattcatcaagaatttaatgtactttatgagttacttgtttagaaagaa

agagagatatgttttgaagaatcatggaaacctgcaacttctgacatcca

tagtagaaaaagaaatggaagtcaatggcttctggttttcaatagtcttt

aaattatgcttttcttagttcaataaaagtacaaacttgctatcaattta

ttttgacggtgcctgtaacagattttgttgaatttaagttgcatcaacaa

gccaactaattctcaatagattataagtaggttggggttagtgtgagttg

acgtgtacttgcaaataataaatagtctggaagtagcagtatcaccatat

attaagcagacagtctactaatactcaaatgagaagtaaatggctttatt

ttgatggtccctaatgcgcattttgttaattaaaagttgcattgaaacta

cattcaatgcagcttttagtcaacaaaatgtgtgatagggcccatcaaaa

taaagtcttaccaaaaactcaaacaggtttgaagcaacacgagagttagc

aaataatgacagaattttaatacagatctacataaaaaggcttttttttc

tttttttttttttactctgacatagTTTTAGGGGCCTGGGCTCTGGCAGA

TGTGCCTGAGCTGGGAGATGTTTGCACAGAAGGGAGCTGTTATCCGGCCA

CAGGAGATCTGCTTATCGGAAGAGCTCAaCAACTCTTGGCCACCTCAACA

TGCGGAGTCCATAAACCTGAGCCCTTTTGTATCGTCAGTCATTTGCAGgt

aaactcaaaatccttctttttaattgttgactaaatgtgaaatggag