DT1P1A10-like protein

cDNA: Genbank NM_173284

 

hi1116a is in the 2nd exon

 

cttataagggatcctcgagagcttagccgtcgttctgcagcgtcgcgact

gggaaaaccctacatacatatatacacacacagtaaataatgtgttttgt

tattagATAGCGGTGGACAACGGCTTCGGTG

hi1116a (5-3)

GAGCGTTCAGTCAGCAGAAGGCGGAGTGGATGGTGGACGCGCTGCAGCAA

TACTTCACCGACAACGgtcagagctctacattcaacaccttagcaaccgc

caagaaacccatgactgaacattctgtcataattttctcacacttcactt

gttccaaaccagtttgatttttttattgcattaaacacaaaataagttat

tttgaagaatgtttgaaaccagtaaccactgactatcccagtgtgttttc

gtactctgggtgtcaatggttttcagggctctttaaaatatcttttgaag

ccactccagtgtgagctggtgagggtgtctaaaatgttctattttagtga

attgtctctttaagagctgacagatggtttgtttgtttgtgtccacagAT

GATCTCCAGCCGGATGAGGTGGAGGACTTCATCTCTGAGCTCATGAACAA

TGAGTTCGACACAGTGGTGGATGATGGCAGTCTGCCTCAGgtctgttgtc

ttttggtcttgacatgagagatctgaatgaaagctagctgggg