elongation factor 1-alpha

cDNA: Genbank NM_13126

 

hi1116b is in the 1st intron, before the ATG

 

ctgcagatttggtagatatccatcagttctaatgttcatctcttattaca

tctgcaatattagtaaatctactgtatgacacactcagatgatgggcgaa

acaaagtggtgacgtcagcctgacgaggcggggagattttcagtcaattg

tgtgtgatttgcgggtcgatcaggaagcggggggttgcagccggccgctc

ggtcctcctcccgcatataaattctccaaccaaagcgtttttCTTCCTCT

TTCTGTTACCTGGCAAAGGGGAGCAGCAGCTGAGGAGTGATCTCTCAATC

TTGgtgagtactataggctaggccttggctttttaattcttgtatcgata

actttaatgcgtatattgaggcttttcttcacggtggcggatgtttttat

gacattttcacgcggcggtttgttatacaacgagcttttaacagttattt

tatgttcgggttttctatgtggcttgtatgtctttcttaaatgttttatt

ttaataagtagtgcgctttaaagttgactttgttgtctctttatatttct

gctgtttcctttattttgtgtgtgaaatgagcaccgggaaaagaacaaag

gcacaagcggtttgaagtcacgggtccgttaaaagcctatcacacattcc

cgcatccagcaactgttac

hi1116b (3-5)

aagtggccggagagccagatgtctgcctcagtttggattccgttcagaga

tttctgtttttttttaatcatcctgtaacttaacaccgtcttactctaaa

gaaacacgtgtcgcagctgccttatggtgaactaggccggttcaaactct

gggccatcttgtcacttgtgttacgaaatcaccgcttaaaagttttaata

atgaaaaatatgtatttttgtggtccatcattaactttcacattttatct

tggtccgcagAAACTTATCAATCATGGGAAAGGAAAAGACCCACATTAAC

ATCGTGGTTATTGGCCACGTCGACTCCGGAAAGTCCACCACCACCGGCCA

TCTGATCTACAAATGCGGTGGAATCGACAAGAGAACCATCGAGAAGTTCG

AGAAGGAAGCCGCTGAGgtaagcgttcaaccggttggatttattcttaat

caatttatgcgcttcaaatgcggcacagttctgtaacgagagccaaaatg

cgggcagcacgcgtttctcggctcaagccggctgggtgtggagtgggcgg

ggtttacgcggcactctcgatgacgtagcaatttctgtaatggcgcctag

taggccgca