ATPase, H+ transporting, lysosomal accessory protein 1

cDNA: Genbank NM_173265

 

hi112 is in the first intron

 

tgctcagactcggaggacgtgaacgaatcgagtcagaagggaatcatatg

atagaaaaaaaaatggtcacgtgacaacgacaactccgccattcacgtga

CTCTCCAGCAGAATGACGGAAGTAGGAATGCGGCGTTGTAGTCTCTTAAC

AATGGCCTTCACTTCAGTTTTATTATTTATCTGCTCGATTTATAGCTGCT

ATGCTCAAGTGCCTCTTCTTATGTGGACCAGTGATGGgtacgtcacacgt

ttatctcttaattatcgcttttagat

hi112 (3-5)

ttgtttctgaagtactccagtgtaagttactcttaggcattttataatac

atgttcaggctgctacgtcgactaacattgacttggtagattctgtttat

gaattgaaaagcttttagaaatgtcagtggttcgatattgtggatgaagt

caaagtcagcctgattctgttgagagagtcttctaactgaatgaaatctt

tgtacataaagGTCCAGCATGCCACATCTGGCTGAAGCTGCAGCTGGGCA

CACAGTGTCTGGTGGGCAGCTGGTGTCTTATCTGAGATCTGCCTTGTCCA

CTGCTCCACACAATGTGCTAATCTTCCTACAGGATCAGgtaaaatgttaa

atttggtggagaaaaaacgcacatagttaatttatattt