RNA polymerase I 140 kDa subunit

cDNA: Genbank AY648731

 

hi1883 is in the 1st intron

hi1124 is in the 2nd exon

 

gcatgacagcaaagatggcGGCGCCTATGAGCAACGTGGATGAAATTCGT

GATAGAGTAATATTGGGCGAATTCGGTGTGAAAAATgtaagttg

hi1883 (3-5)

tacccacttgcgggatatttacacagtttctacgtcgtgtttatgtcgat

aaagtctgtttcacaaatgaaattgttcccttaatatgtattagatgcac

atgtcataaaggttttttcgtactgtctcttacaaaaacaaatcatgttt

tttattgtaataagtatagtaactattgcttttgtcgcataaagcgttta

taaagtatttacaattagttttgatggcatttccatggtttaacaaggtt

agtatggcgaaagaattgtaaataattggttgccatactttaaaaactaa

atttaaaatttgttgtaaaagcatggttcatttatgtaaagggtaaatgt

ttttatgtgttctcatgtattgggtattaaagtgtattctgataagctac

acatgtacctaatattaactgtatctaatatttacagGTCCATACTACAG

ATTATCCAGGAAATTACCCCGGTTATGAT

hi1124 (5-3)

GACACTTGGGACTTTGAAAAATTCAAAAAGgtgtgtgaaaagtctacgct

gtgtcttaattctagctaattttaatgtttaattattttttttatgtttt

taaatgttctaaacatgatgtgatgtcatgtcttttgaactctttcagAA

TTTCAGGATTGAAATAATTAGTTCAGATGAAAACACACTGGAGTTTGATA

TGATTGGCATAGATGCTGCCATCGCCAATGCTTTTCGCCGTATATTACTG

GCTGAGgtttgttgttgaggatatgttcttaccatgtctgctttatttat

taccatc