SRY-box containing gene 9a (sox9a)

cDNA: Genbank NM_131643

 

hi1134 is at the splice acceptor of the 2nd exon

 

TTTCGCAGACACCAGCAGACAACAAAACACACACACACTAAATGCGTGCC

TAAAAAAAGCGAGCACCGTGGATTTGCAGGAATTAAAAGCTACAAAGGAT

TTTTTGGAGGCGCGCTCGAATTCTCTGAGATCGTCCATCTACGGTGTTCG

CATGAATCTCCTCGACCCCTACCTGAAGATGACGGATGAGCAAGAGAAGT

GTCTGTCTGATGCACCCAGTCCGAGCATGTCCGAGGACTCCGCGGGCTCG

CCCTGCCCGTCCGCCTCGGGCTCAGACACTGAGAACACGCGCCCGGCGGA

GAACAGCCTCCTGGCTGCAGACGGGACGCTCGGAGACTTCAAGAAGGACG

AAGAGGACAAGTTCCCGGTGTGCATCCGAGAGGCGGTGTCCCAGGTGCTG

AAGGGTTACGACTGGACGCTGGTGCCCATGCCGGTGAGGGTGAACGGGTC

CAGCAAAAACAAGCCGCACGTCAAGAGACCGATGAACGCGTTTATGGTGT

GGGCGCAGGCGGCGCGCAGGAAACTGGCCGACCAGTACCCGCACCTCCAC

AACGCGGAGCTCAGCAAAACTCTGGGAAAACTTTGGAGgtgagtaattca

ttacatcagtatccaaagtccctttctttcttgggatgattcataaaaca

taataaagctgaatgtgaagagttcagctgcaaaaaaaatctgtaggcgc

cgtcagaaatgtccatcgaaaattttaatttttctcagccgcctttattt

atgttgtgttatttcacttttaaggccttaaaaatggcgtattgttggcg

ataaaagtgatattactgaacctacacacatgagcctgatagaaatgctc

actccagaaggaaacttcagatggcactgagagttttctgcatctgaact

cttctttgcgcgttttttgcgtaattgtgtagtcagaacacttctgtttt

atttatgcaatcctgttgctgctttcttcgctcttttttaagtgtttaac

aaaagatttgattagtttaatattttattgtttaatgtgcgtgctaattc

gtccgcttttgtgggc

hi1134 (5-3)

agATTACTGAACGAGGTGGAAAAGCGTCCCTTCGTGGAGGAGGCAGAGCG

CCTTCGGGTGCAGCACAAGAAAGATCACCCCGACTACAAGTACCAGCCCC

GGCGGAGGAAGTCGGTGAAGAACGGCCAGAGCGAATCTGAAGACGGCAGC

GAACAGACCCACATCTCGCCCAACGCCATCTTCAAAGCGCTCCAGCAGGC

GGACTCGCCCGCGTCCAGCATGGGAGAAGTGCACTCGCCCAGCGAACACT

CAGgtgggacactaaacttgactcgccattcgattcgattacttgttttg

Agtgtatattgcgtcatctgagcaatgctgggttcttaaaatgc