structural maintenance of chromosomes 4

cDNA: Genbank AY099521

 

hi1143 is in the 1st intron, before the ATG

 

 

aaccatttaaccttttattttttatatttattttattttcacagcgtatt

actttatcatattttcagtgcttaattaaataaaaaacagcagtttgtgg

tgaaaacgctttgtttgtgtcatgtggtgtttttccctttctaatactta

aataaaacattgtttgtatatttatatttatatcttatttcctgatgcac

acattcggagtgcttgctttcaccgaattagctcaaataaaccacaaaca

gaactctccggtcacgtgaccttaagagggcggacgccttcccatgaagc

accgcgcgggctacaacggactcGGGTTCGTGCTCTGAGTTTACGCGCCA

TTTATGAGTGAGATTTCAGTACAGGGAAGTAAACGAGCGCAGATCTACCC

TCGTTTTACACCACAAACACTCAATATACGCACTTTTATTCAAAAGGAGA

GCAAAAAGCGGAGTAAAATCGACGAGAAAGAGGGAAATCAGCGGAATCGA

AGgtaaatgttgacactcgtgtgcatcgtcaaatgtaatgtcagtttgct

gtgtttacttcatatgacgttaccgatctcacaaacgcgatttctgcaca

tataaaacatcgaaatacgattaaacatcacatcaaatattcataaaaga

tgatgttttctcttatttggtagtttgaactagttttaac

hi1143 (3-5)

cggtttcgttgacttttctttccactatatttaaatcaaacgtgaattaa

ttatgatcctggagcaaaacggtttattaattacgctttccgcagtttct

acaagtcctcctatgtctatttttaatttgtgaatcatttcagacagctg

ttggttgcaaacatgattgacacgtcgctttgaaaacaatagtttgtatg

atcacatcataactacattttacatttatatttttaaaactcaggtgaca

cataaatccatttagacattggtttctgttttatttgcccctcacatgat

ttaactgtttaattgtagtttattggatagcatgcagcagtttaccatgg

ttttgtttgcattactctcgccacaatgagtggttactgaactcgtaatg

gcgagagaaatataaataaaaccaacttgtctgtaaaaagtgtccgagtg

aagtttttccctcgtgacgtgttcggtgttgtcatcatgtgtggttaact

cacaaacacgacgttatagtgaagctgtgcggttgtcagctctgttttcc

tttgtgtgcgcgctgaactgcgacgtcactttagttcagtcgcttttatc

acgtttatttttgcatatatcgtatcttcatctctgtttgtggacatgtt

ttacccgagaagtgtgaacaaagaaaaagccagactccgctgtattcgtg

cagacggatgtggggttgacaaaggcgaatgtgcttttcagGTGCCGTGA

ATAATGCCTGTAAAAACAAGCAAGACGGCCGGTCGGAGAGCGGCGGAGGA

CTCGGATGAGGAGGTGAGCAAACCGCGCAAAGCACCGAGCACTGCCGTCC

AGAGCAGCCCGCCGCCCGCCCTTAACGgtaagagaaccggagacacccag

aaagattaattgtaacactttgc