cDNA: Genbank AY648733 / XM_682004 / EB858924

 

hi1146 is in the first intron

 

aaaaatgaatgtgctaaaaaatacactgaataaagtctgtctacaacagt

tcgaatcaacttgttcagattggtcggctggtgagaacgtcatatccgct

gctcGAGTTTCCCCGGGAAGACACTTTGGCGCGGAAATCTGTTGTTTTGG

CTTCGCCCTTTGTAAGGAGAGAGAAATTCTACCTCGACTCAACCGCATTT

TATATCAATGGCTCCTGTTTCAAATCCCGATAAAGACATGGACGGCGGAG

ATTGTGgtgagcgtgtttacagggattagtgttgtt

hi1146 (5-3)

agctaacacaatattccagctttcagcttagcggatgcatgtagtgtact

gacagcgctaatgcaacatgaaatacaatacattacattgatttatctga

gctaacttaatcgttaaaatatgcaaatacattaccgtgtatcatcattt

tgtcgagtaaacgtgatgtttcggtccttaaacatgaagtttgaagctga

acatgtcagtattaaggctgacaaatgtttctcagttctcagctagcgtt

aacgttactctttcctggataacgttaatacattagtgcttctttggaag

acgtttatgtaacatcccagcggatgcccagcactggaaaaagaaaatta

ataaatcataaacaataataatgtaatatacagtgacataataacactac

tactacttactgcactactaacactactactacaatataataattataca

attaaaaatattcttattgccacagatgaaaatatcctttataatgaaac

aatattgaaaaaatatgatataattataaatattctagtcacttaaatgg

tctttttaacaaagaagttagcaaaatttcactgaatcacatttgtggat

ttatatatatatatatatatatatatatatatatatatatatatatatat

atatatatattttttttttttttatgccacatttgtttatgcctttagAT

GCATCCGACACATGTGGCATTGCCGCCTCACGTTCCAGAAGGGAGAAAAA

AGAGAAAGTCGGGCGCAAGTCTGCTTTAGAGCAACTTAAAAGAGCCAAGA

AAGGAGAGAAAGTAAAATACGAGgtgagattcagctgtttgtacatttca

tctctgctgtttcagcgctttgacattgtgttgtgatcagGTGGAGGAGT

TCACCAGCATTTATGATGAAGTGGATGAAGAGCAGTACTCGAAAATAGTT

CGGGAGAGACAGGATGATGATTGGATCATTGATGACGgtcagtcatattt

tcatacttcaatctccaatatgcaaatttcagtgtttaattggttgtcag

attaatgtgcctgtaaaatgctgggttctacacaattcatgtcttcatgt

gtcccaacacaaatcgtagg