splicing factor 3b subunit 4

cDNA: Genbank AY099515

 

hi1159 and hi4070 are both in the 1st intron

 

acagtctgactgggtcctggcttagcacagctgtggctccattttatgac

ctttaacaacataaaagacatattaagtaacttccgaacaaaaacagaca

aaggacgtagtaaatcataatttgacatccacaaaatcggcaatgttcat

cttcctctcctgtgggcggcagcactgcgatgacaagacgatgttgaggt

gatttcagcaaaaagaactgcttccgtctgtACACACGCCGGGGTTCATC

ATGGCGGCGGGACCGATTTCAGAACGAAATCAAGgtatatttgataaatt

taactttttagtgaaattgttatgtagtgttcggggtaagtgatggattg

cagcattattgaacaccttaagttcttcctatgttctatga

hi4070 (5-3)

tacagtcaaatcgctcattttcattcattcaaacatgttggcttaac

hi1159 (5-3)

aaataaaaacaaagaaacgtttgagttttggttttaatgaagtgtaacaa

aacaatcatgcatatttcaatatgcttattattatcggaattaataaatt

gtatataaataatgcatctaacgttaaataaaatactatgtttgtgttca

gtgttgtcatttatattgatcatcttttatctgcagATGCCACTGTATAT

GTGGGTGGTCTCGATGAGAAAGTCTCTGAGCCTCTTTTGTGGGAGCTTTT

CCTTCAAGCTGGTCCTGTTGTAAACACACACATGCCCAAAGACAGAGTAA

CAGGACAACACCAGGgtgagttaccacgtctttaaatccattggggtaaa

gttgcttttatactccctcattcggtct