telomeric repeat binding factor a

cDNA: Genbank AY099522

 

hi3678 is in the 1st exon

hi1182 is in the 1st intron

 

gtaaaatcattatattcacaataataataactgaagtaatattttccagt

gacgttcgcgccgtcagcatcgctgctggccaatcggggccgcctcgccg

ctaagccccgccccTGTCCTACAGTCTGAGCGCGCCCGCGGGAGTTATGC

TGCCGAGGCTCACATTAAATCTGCAAGAATGAGCGACAAACCCTGCGAGC

CGAGCTGGGAGCAGATCATCAACCGCTGGAGCTTCGATTTCTACGCGTTC

CAAGCCTTCAGCGCGTTCAGGAATGGAGATTACACGGCCTTCACACAC

hi3378 (3-5)

TTCATCAACATCATCGAGAgtaagttcgggggcgcgagagtcagctagca

ttagctcttcagctaaacacacaaactcttcctgaacacgggctctgtct

cattcactcgctcaccgagcactatatagtgcactgcagacgaggggact

gcgttaggaaagagccaggcgaatgtggaccagaatactgtagtatatat

cagcagattatgagtttgacgtcagtgttatattacactcttacatctat

tatttgataccaaagagtgcaaaattaacctgaatacaagatataaagat

acaaatagtgtataaatgtgtgaccatgaagcatagatcagtgttataat

gcacatgtgtgattgtaggaacagtaaacaacacattgtatgggttaaaa

ctctgtatgtaatattaa

approx hi1182 (3-5)

ggtaacaaatatagaccctatcaaactctttcataactgtaacaagaggc

aattcaatcataacatcatgttaaactgccctcataacattattgatcaa

tatgaggctctttttggattctcagaagctgtaggagttatgaatgtgaa

acaggaagtatgtcaggtcgaatgtttttgtttacatccttcaaaatggc

ctgtagagagagactcctcactgcagatgctcctcctcttcttctgtgtg

cagGTGTGGTGGTCAGGCCGGTGGACGGACACACTGACATGATCCCAAAG

CTGCGCCTCATGCAGTTTCTGTCCAGGATCAACAACGGGGACAAGCTGGg

tgagtgaatgtcggagacgcgcgcagtttctgagctgcacatgtgctgtg