ATPase, H+ transporting, lysosomal, V0 subunit c

cDNA: Genbank AY099523

 

hi1207 is in the 1st intron

 

cagccattgcacaatgtctaaaaagaagtattttgcgcactcatagagtc

atccccgctgaatcggaaatggaccctgcactcatgttttgatcatgtga

ctctcttcatttcgcctttTTCTTACTCTCCGCCGGCGACCAGCCTCCTG

TCGGGTTCGTGACCGTTTTTCTTGCTCCTGCAAGACCTGTCAGCCAAAAG

AAGACCTCACTCAGAGTCTAAACCTGCTAGACTGAAGCTTTCCTCCCTTT

TCTGCCTTTAGTTTTAGTCTCCCGAACGCGCGAGAAGAATGGACACCCAG

AACCCCCAGTACTCTCCCTTCTTCGCAGTGATGGGTGCCTCCTCAGCGAT

GGTGTTCAGCGgtaagaaacgcgtcgtt

hi1207 (5-3)

taacccctaaattaaatgtcattcagttgaaatgctttattgaatgtgct

gtctctttattgaatcgctggctcgtgtataccttttgtaggacgagaag

atgggatgcgaaggtttccatcacggcacatgacgtctcagttgacgtaa

tgtccataaattatttatttcgtttcattatattcccttcatttcgctac

gtggaaaacttaagacgccgttcccgtctcgcttgagcagggtatcctgt

tgtaatgtttgcgcaaggacgttgtttatttaatgtcctttatttaaacc

ttcctttgtgatcatctctaatggcagacttcatatattgggctggagtc

tgtaataagagcagcgtcgtctctacgcgattgatttgtgtcaggcctag

accaaatgcattacttgattaacataaacaggttcgctcttatcaaatgc

gacagccctctttttgttaaaacacgaactacacgcccaggcaaaacgtc

cttgtggcagctgtaatgtccattttggagacttccttgttgttttattt

ttcgtcaaaggaaaggtatcacgtaagtgcttattagattgtataagtgc

ggtctcagcagtcttggagggtccaaataaatgttggattcctaaaagca

aggactcgtcgcc

 

approx 5 kb to next exon