40S ribosomal protein S12

cDNA: Genbank AY561510

 

hi1227 is in the 1st intron

 

taaaaagtacttaaatgttaaaacgatactgagcgatatttattgaataa

aataaatcagcaacactaaaactatacacaatgaaaacgctataaacagt

gccgttgctttccacgcaggcaatgagttgaacaccaacggggcccttta

gcgcttaaagcaatgttgtcgacactatgacgtcctctttacccgcagtc

agAGGGAAGGTAGGGCGAGCTTCTGAAATCTCTGACACAATCGGTCTTAA

ATATTAACCATCCTGCCTTTAAAATAACCCGAGATGCATCCAAAGCAACG

GATATTAATATATCCATCATATTATGTCTTTATTTCAGGAATAACTCCTC

GCATCCATCGCTAATCTACAATGGCCGAGGAAGGgtgagtgactgatgct

acatcacccttcatagcatgcactgctccgttaagaacatttataaacga

gtattacattatttaagtattaaaaaattatttataacctgtatgttatg

aaacaattacttttccccttactaatacaacttaatataacgagctgctg

ctcaaagaaaactaattgtaagttactag

hi1227 (5-3)

tagcacatggctattattttaagccgatcctgtgttaaaagctttatgga

ccatattgattgttcccattcattttccttgtgataaaacactggtcagc

ttttttgtatgtataatacacatctatacacatccattctacaaaataga

cacgagaaaattacttctattgttagttacctttagcatgagtgtacttg

gcaggtgtgactcaattacagggttattcatgagtattaaatctaattaa

agtccatttcagaccttattctcgcttaaagggatagttcacagagaatt

tacttcacctcatgggactcaatcttaattcctggagggcctcagctctg

cacaattttgcttcaacctgatcaaacagctgatccaaataatcaaggca

ttcaagagtcatgaacaccattagttggatcagctgtgtttgattagggt

tgaaaactgcagagcctcagccctcctggaattgagtctgagacctatgc

tctacctcatgtggttttaaacttgagtttatttctgtttttctaaaatg

gtagtgttcaatcagcattcttcaaactatctcaacagatgaatctcaaa

ttgtgttttgaagaatggcactattttgggtggactatccttttaatggt

gtgtttagtcttgttgtaaagtttaaaaatgtaacttgtataaaaaaatg

cattgtgtgctttctagttttttttttaatagtacttttaatttacatgt

tcaattagaagtcattttgacatctcatttgtcttaaatttaatccataa

tagtatttaagctcttaaatttaacttgagagtaagtgtagaccgcggtg

ttcatacttaaagtaaaccgcatcggtttaattcacttcctaaataaaca

gacctcggctatgatgaattttcaatctttagtcggataccccttcactc

ttaattatgagtgagagatccagtctgagaagccggaggttgttaaatgt

acacacgtgcaccattgtccctttccaccccagtgacgtcctcttgtgtt

gacagCATCGCTGCCGGAGGTGTGATGGATGTCAACACCGCTCTGCCTGA

AGTGCTGAAGACCGCACTCATCCACGACGGTCTGGCCCGCGGTATCCGTG

AGGCCGCCAAGGCCCTCGACAAgtatgaatatttttacttttagcattct

atgacacttgtggtgtatctgtgatgataatttggctccctctactgaag

tctctgaggaaaactgccattcgttacccaatttcttactgagatacttt

tgggggtgattgctcatacctgattgaggaggtttgaaggctgataatgg

tttgtctgtcttgcagGCGCCAGGCTCATCTTTGCGTCCTCGCTGCAAAC

TGTGACGAGCCCATGTACGTCAAGCTGGTGGAGGCTCTCTGTGCCGAGCA

TCAGATCAACCTCATCAAGgtgagcaagctggaaagatgttaaagggata

gttcaccaaaaagaagaatctgttcaaaacatgtttgagtttttcttctg

ttaaagaaatgacatgaaatcaa