GINS complex subunit 3

cDNA: Genbank AY648732

 

hi1241 is in the 1st intron

 

gcttcatgtcaatgagtatttgagaggttttgcatattcatcgatctgct

atcgactgatcgcacctgttcgatgttccctgtgctcgatgctccattag

tttccgcttgaagttgcgcgccaaagctgctctgactgtGTTGTTGTTTT

GACTAGTTTGACTGTATTTCCACCGTTGGTTTGCGTTTGTTTGATTAACT

GTCGCTTGCTTGCAACGTAAATGGACGCTCAATCCTACATGCCCGTGCCT

CCGGGTGTCGGAATGGAGGAGAATTTCTTTTCTCTGGATGATATTTTACT

TTCCCACGAGCGACTACCATGCAGGACGGAGAGCGCCTTCCCGAGACTCG

GGTTTCTAGAGAAATCCAGCGACTCCCGAGACATACCTGAGgtaacgtta

tactaatgcatttacatcactgatgctagttttaaacggttataaag

hi1241 (5-3)

gactttattttaattgtgacgagcactctatgtactaaagttgtattaaa

actgtcttgaactaaaactgctgggcctatttgtttttgttgagcttgtc

ctatatcttcatgcataaaaacatttttaaagcttttatgattcaataaa

atgtttatttctgttatacgtaggtttgcaatcaatgttaatacagttcc

tatagtgtaaaattaaatacaagctatgtaattagccttccctgctgaaa

aacaaaacaaaacaaaaaacagcttgatcagccaaaccaggctgagaacc

aagccaaaaccaactatgtccagcttaaagcaggctggtcattttccagc

ctgaccagcttagaccaggctggaaacttgccatggaagggccaaacccc

ctctaaaactagccaaccagcttaggctggtttaagctgtgtttttttca

gatagaggtaaagttggttttatattcgcacattcgttcatttacaaatt

tctatattgtttaccatgttattttgaacattcaattggaattagcatgc

aactggcttgaaaacaacattaacactgtttatttgactgtgagcaatgt

tgtactttgatagtcattggctgctaaactaatatgatttcgcaatttag

aatttgaaaataatacttgtatgaaattatattattaaggagaaagtcag

aatgtcaaatataactccaacttaacctctgtttcttttcaacagggtta

aaaaatgtctgtcgtcaagttttttcttaatttcaatgaaggaaaaaact

gacctggtctggtttggggatcctgcccctctggcattattaggttttgg

tgagctatcaacttatcaaaaacctgttgatagaaacctaatgttagggt

ttcagttggatagtgatctgacatttaacagacaagtaaattcatttatg

acttgtggcaaaagtgaagtaatttctctgttttaatgaccttgaaaagg

ggattcatgcttttattttggaaagacttgactattgcaactttttgtat

gtaatgattagtcaaaatgccctgaatagattgcaattaatacaaaatgc

ggctgcaagacttgtgacagggactcagaagcatgagaacttatacccag

ttcttttctctgggctggctgcctgttaggtcacagattgattttaactg

attaatttttgtttttaaatccttaaatgatctgccaccaccttacttat

tagatctcttacatgattaaaatcctggtaggtcactaaggtcttttgat

cagtttattcttttggtaccaaggtcctggtgtaagcgaagtggggtttg

ggcttttgctgttatcgccccaaaactctgaaataagcttccccacccac

attagatgcactccaactttatctgtttttaaaaagattctgaaactgca

tttctgttctttagattttgagcctttttaacgttgaggggtttgcctta

tgttttaattgtttgtgatgtaggacttatttttattagtactgattgtg

ttcagaactttgggcaacattgtgttgtagaaaagtgtgctatataaata

aacaaactaaacttaatagtgttaatcagaataatatcatgagttatttt

taataatgccatttccacctaaagacattattaaaatgacacatttgaca

tgtggaaatgttgctgtagaacagttctaatctgacattaaaacatgtca

aatcataggcttatgtttagaaaaggcttaagttttatatgatgtttgtt

ggactaaattaatctgtacatgaacgctttttggagttttgcatgttggt

ttacttgactacagcattaaaataaactatgacaatgtagtgcacataaa

caaaaccaacaaaatacagtaccatcattttatacatgtaaatgataaaa

attaatttgtgaaatcagtgatgtcatatgttttcaatacttgttcatat

tataggcacgtgcaactattttacaacacaaacaccatattttgccactt

gcatagtagtgtgataatttaatgctaacattgcaattcattttttagGG

CTCAAAAATGGAGATGCCACTTTGGCTGGCCAAGGGTCTGTATGAAAGGA

AGAGACGAGTGCTGTCTGTGGAGTTGCCAAAGGTGTATCGTGAACGCTGG

AGAACAGTGTTTGGGGCTGATCCCACTGTTGTAGACTTGTACAAAATGGG

GCCTTATTACTATGGTTTAGGTTCCCAGATGCTGCATTTTGAAAGTCCAG

AAAATCCAGAGATCGCTAATACCATCCTCCAGgtgagccttgagtagtcg

tatataactatataatatatggcgatgagttctgtttaatcttatcttgt

tagtactgggtagttacaacaaagcatgagggttagcgtgtgcctcttca

cattttgaaattgttg