MCM2 minichromosome maintenance deficient 2, mitotin

cDNA: Genbank AY099531

 

hi1244 and hi3205 are both in the 1st intron

 

aaatgtccgcctctttcacgcgtcaaaccaatgactgttcagtttaacgt

gatacgggttgccacccgaccaatccagtactcaaattctctttctcatt

acatattcatagcctttcgcgcgctttctggtcacatggagcatttcgcg

ctaaaagttagtcttcccgggaaaactaGTCTACAGTCGAGCTTCTGTTC

AAGGCAGACGTGAGACAATGGCGgtgagtagtttttatgtataagttata

tatttctgtgaacaaatctgttaaacgtcgtttaaaagtatttcgcaata

tgtgaagttggccaatgtgttcgtggtgtgtaaaattcgcgtgttgaaag

catttttgcacgtagatgaagaaatgtaatgttctgtaaagcagcataat

caataaaaagttgtaaggttacatgattttaggcaaatgtgcgtttacac

ttgcacatatgtcgtgattttagtgttatgtgatgtgttttgacataacc

aaagctgtcaagtagcttaatgtagttaataaaataattttaaaaacatc

aaatattcaaaaatattagctttaaatttatcaaaagctaaatgtgtagc

gagtaaaaatttaaataattaaaaagtatctttagtaatgtcaagctc

hi1244 (3-5)

tttcagtaaagtcccacgtggaaaaactagtttctttgttgtgg

hi3205 (3-5)

tccatttagttaccagttcaaacgttacaaaatggtaatggatgacttat

gtttaataagctgagagacggacaaatgtaattttctgaattaatgatat

tgtattacctcagctttattaaattatccacatgtaacatgcatttccgc

actaaccatcagtctcttcaaatttattctgaggtaaagctgggttaaat

ttacacatttatactttctctgtagtaatataattttactagacttttat

ttgcaaaaaatattaggccaatcatattagcagccatgctaacaatcata

ttgttttaaagtcatgtttacatgtaatttaccaccaaactttcaaagta

taccatgg

 

at least 650 bp to next exon