FLJ20272 / AK027570

cDNA: Genbank AY099524

 

hi1257 is in the 5' UTR

 

aattctgtgttggcatggatttccaccgggtgcttcagtttcccccgcag

tccaaagacatatagctgaattgggtaagctaaattggccatagtgtatg

tgagtgtgtgcaagagtgtgtgggtgtttcccagtgttgggttgcggctg

gaagggcatctgctgtgtaaaacatgctggacaagttggcggttcattcc

gctgtggcgaccccagattaaaaaggaactaagacgagaagaaaatgaat

gaatgaatatattattgtatatttgtcttttatttgacattagcatattg

tttgatgtggccgacacgtcggtgacttgttcaagaacaacgttttattg

ttatcacattcattaacctaatagaagtaagaaaaaagaaaagacgacag

aactgaagatagataatctgctcttacactaagctgtttatcaacagtga

atttacgttgcgctcatttgcgcgtctggtcaaatctcgacgctccctta

gcgctggcttattaagtATCCCATAATGCACCTCGTCGCTGTCATGGCTG

CTCACTGATGACACTTGCGGCACATGGGCAGAAATCTAACACATTACAGT

GAACACACGAACCTCAACACGAGTCTCACACTCACACAGAGAGCAGGTCC

TGAGCGACGCGACGCTGTTTCATTCTCCGCGG

hi1257 (5-3)

AACCGGGCACACAAGGAGCGCGATGCTGCAGCTCGAGGCGGCGGTTCTGG

GCGGATTGAGTCTGGACTGGAAACAGAGCAGCTTCAGCACCGCAGgtgag

agacaacggcatgagagccctgagtttgggaaatcagcccactttcagtt

gaacgcggcggttatgacagatgttgatgctgtcgtgcagctgtggagga

tgtcagggctttaatctgctcggttcttgttgtggatgatgagtgttgcg

cgtgcagtctgtctctcacgtggtgtaaatgtgccgcatgtgtgttgaaa

tcgggactgtgtccagacagaccgaaagacagacagatgtgagtttccgc

tgactgtgaactaaccgggcgcgatttgacagcagaacttctgtggttga

taactgaccgtatggagg