TAL1 (SCL) interrupting locus

cDNA: Genbank AY099525

 

hi1262 is in the 1st intron, before the ATG

 

agatctgtcgatcttctaaatattgtcatgaaataaaataataataaatt

aagttagatgtacatttttaaatatgtataaattattattataatgcatt

gttatttaaaagttatattttattatgatatattgtataatattaataat

aatatcagtttagccattgatcaatgaaatatgtacaaaatatgaaaata

tgtatttaaaaagatttttattaaaacgtatgtctacattaatattatat

aaacatagcaggtgtgaagtatttctagagtaaaataaaatatagggtcg

aaaatgtacaattaattcaacagttttctacaataaatatgtattctcgt

cctatcagccattcaaaaccactccgcgagcaagctgggaccggttcctt

tatgctgattggtcgagagcccctcgcaagtctatttctattggttgagc

cgccctgcagcagcgccccgccattggaacctggaaacagcgccacaaTT

TATTTTCGAGTTGTTGCGTTTGTTGAATGCCCTCGTCTTGTGTTTCATTG

TTTATTGACAACAACCGGTATTTCTCCGTTTTCTATCACGCCAAACGGGT

TAAATTATTAACCCAGAAATCATTAGTCGCGTCTTGCCGCGGTTAAAACC

GCTCGAGAGCCTGGGAGGACAGTTTTAACATATTTGTGGTTCATATTCAC

GCTCACACCCGTACGACTTTCGATTAAAACACGACGAAGGCATGTGCAAA

CCGTCCAAACAACCTGCAGgtgagagtttgcacatcataacattaacgga

tttataagaatatctaaatgtgcgtgattggtttagtggtt

hi1262 (5-3)

cttatactaaccagtcgattgtactaacacacgttagcatgcaagctaag

tcaccgaacctgccaaacttctgtaaatgttacgtttggatagcttatct

aagatgttttaaatatgcattgttttacagttattagggataactttatg

ttcaagtcgcggtcagtataataaattgccttgtttcaacagGATGAACC

GTGTACAAGTGGATTTTAAAGGGTTGCCAGCCCACATCTTGGAGAACAGC

ATTGCAGCAGAAAGCCTTCAAAACACTAGgtaactgttttaaatgcattt

tgtctaagtcaccatataagttcaataaatgtaatgactttacatatttt

cttaaagGTCATCAGACAATGTTCTCACTCCATTGACATTTCCAAAATCT

AAAGTGGCTCTGTGGGATCCATCTGCCAATGGTGAAGTTGTGAGTCTGCA

TTTCTCGTATTACAGgttagtctttcattaatctatttggggaatccttt

tttttaggggtgcactttattaaaaaaattctgacattgcaattaattcg

tttttatgggttatatatatatat