60S ribosomal protein L24

cDNA: Genbank AY099532

 

hi1284 is in the 2nd intron

 

ttacagaatagtagggttcattcctatgtcaaatatatgtttacttcaaa

aaaatattttactttaacgaaacgggctcctttataaaccgcttacccac

aattcctcttcCTCTTCCCCGTCTGAACCGCCGCCATGAAgtgagtgtat

tctgtgttcatccccaaacatctgcaatataccctcacagatgcgccgat

taaagtgtttatgagttattaatgttcgcggcgtgtctgtaatgacgctc

atttgtgctctgcagGGTCGAGCTGTGCAGTTTTAGCGGATACAAAATCT

ATCCCGGTCACGGCCGGCGATACGCCAGGATTGACGGAAAGgtaaagccg

agttactccgacaccagcagctcactaatatcatcctcattattattatt

aatattgtcattattattatgtgaatattcgtattcatcagggtagttcg

atactgttggctaactacagttagcgatgggttagtaatggcgagccccg

ctgctaatgctaacacagacactgggttactctggctaatttagcgtcat

tatgagttcagcatgatgggttactttactgttctagagttatat

hi1284 (3-5)

tagggttcgggtttgctgaagactgttgccgatcagctgtgtgtgtacac

acacacacacacacacacacacaaatgtatgtctacatatctgtgtgtgt

gtaagagaattagtggtacgcgttgttattaatataagagcatctcctcc

tcttcctcctcctgctgctgatggtgaagtgctgaatcccgcatgctctg

gctgatgtgttcaggaactcctccagtgttttggctgagcgctgtagatt

gtgtgttagggctgatcgattatgggaaaaatcataatcatgattatttt

ggtcataattataatcacgactattcaaaacgattttcagttcaaaatta

ttcgcacttctgttaatttattatatataaatatttaccaaattatgttt

aacggaggaattttgacaggattttctataatatttctcctggaaaggct

tatttgttttattttggctaggataaaatcaggtttgaatatttttaaac

cttttttaaaagctcaatattattatcccccttaggcaatatatatatat

atatttgattgtcctcctgttatacaatgagttgcctgtttacccgagtg

aagcctttgaatgtcactttaagctgaatactagtgtcctgaaaaatgtc

aagtaaaataattatgtgtctgtcaaagagaaaagaaacgctgtcacttt

aagatcagtgcggctctgatatggtttctctcacatgttttgattattac

acaaatgagggttaatatgaataatcactaaacactgcgctctgacacaa

atgtgcatgtgtttgaccattaaagcgctctcgttaagatgacgttagat

gtgcgtgtgtgctctcctgtccgaggctacacaaacacacccacacacac

acacacacactacctgtccgaggctaagcgctgtgcacacacacaacagc

acatgctctttcgcgattttaatagctgagctgtacgtgtctgcagaggg

ccgtttagcatggagcgcttcagcacaggtcactggggtccatgtgtgat

tattgattattgattatgttgctgtgttctgatggagatgctcttctact

gcagGTTTTCCAGTTCCTCAATGCCAAATGTGAGTCTGCGTTTCTGTCCA

AGAGGAACCCGAGGCAGATCAACTGGACCGTTCTGTACCGCCGCAAGCAC

AAGAAGGGCCAGTCTgtgagttcattaacattattcaccgggcacatgtg

cacggggggtgtatagtctc