40S ribosomal protein S3a

cDNA: Genbank AY648734

 

hi1290 is in the 1st intron

 

tcgaaccagcaaccttcttgctttgaggcgagattgctaccctgtgccac

tgggttgcccgctagtattttaaaaaaaaataaaaatacattattcagtg

ttactacagactaccagttaagtatttaataatttttttaaaagtttcta

cagtttaaaagatttccgacaccctgaaaaaaatctttaattagggtatt

aaacataaatgtacaatgttcacaatttttttcagttcagctatctagtc

aattgttatgatgtgaccctgttgtttcacaaaatgtttataaaagtttt

ttttttttttttttactttagacagctaaatgtaacttacaatgcatata

taaggtagttaaaatgaaggatacttaggcagtagccatacatatatgac

atgttgcctcacccattattattaactgatttaataacgctttaaaaata

atcatttttcttgacgaggaaaatgtgaacaagaagttttgaacatgaaa

gttacttaatcaaaaaaacaaacaaacgtctaaaaatgatgaagtgaaat

aatacacgtaaacaccagaaggcgcagttttgcttagcacagcgaggttt

gtgaaatctcgcggggtttgcctagtcccgctgtatctttaactctcgcg

gtatttcctcacttcctcctcttttactccctgtgTTCAACATGGCAGTC

GGCAAAAATAAGAGGCTGACCAAAGGTGGCAAAAAAGGTGCCAAAAAGAA

GATgtaagtcgcaaatgagtctttcagttgtgtctatacagtg

hi1290 (5-3)

taataagtgatactgaaggacatttgatttgtatgggtaaaggatgttat

cgatatagagaggatcttgtgtagcggttatgctagtcacactggctcat

aggcggcccttgtattatgcgtgctttagtaacttatgtttagagctcgg

taaaagctagcgctgttttctaatgttctcgttttacaaatattataaag

cgttcatttggtcaaaaatacgcacggcagactgatgtctctagcattat

gggccattgaaagcgctaacttaagttactctactgactgtagacttcta

gtgacccatgtgttacaggcttaaaggtgttatgaagcatttaagacatt

acataatatttgttaaatttcttgatgtaatattgaggcttcgttgaaac

ataagcttgttaaatgactctcagaattgtaacgttattgacaagtgtgt

tttctcttgcagTGTGGATCCTTTCTCCAAGAAGGACTGGTATGATGTCA

AGGCACCAGCCATGTTCAACATCCGCAACCTGGGCAAGACCTTGGTCACC

AGGACTCAGGGAACCAgtaagt