parvin, alpha (actopaxin)

cDNA: Genbank NM_001002872

 

hi1320 is in the 1st intron

 

AATTCCGTTTCCGTTCCAGTTCCTGGGATTTTACTCTCTCTTCCTCAGCG

GGGGGAAATATCCTATTATTTCTTCTTTTCTGCCCTTGGTTTTGTTTGTT

TAAACCGATGGCGTCTTCCCCGCAGAAATCACCGTCCTCTCCCAAATCTC

CGACTCCAAAGTCTCCGTCCTCCCGAAAGAAAGATGATTCATTTCTGGGA

AAACTTGGTGGAACTCTTGTCAGGAGAAAAAAGGCGAAAGAAGgtagtga

ttgagtttcaaatgcctattttgctgggaagtatgtttaacacgctttac

aaacacgttaaatcataacgtttttttgaagaagtcttcaagtcaccaca

caactttttcagaagtctgaatgattccctcctccatcgggactggcgca

ggaatgcgtttgtttacactgtcaacatatttgtttctaatataacgtac

actttaacttaatgtaatcgacaaaggtgtgtttctaaagagtaacaacg

taatgtttacactgcaaaatgtgtagcgccttgtagcgatgc

hi1320 (3-5)

tttactcacggatgagtcgatcatttgagtcggaactttttttattagcg

gaaggatcgattcttttggtcttcgttc

 

approx 12 kb to next exon