forkhead box I1 (foxi1)

cDNA: Genbank AY242057 NM_181735

 

hi3747 is in the 1st exon

hi1359a and 3239 are both in the 2nd exon, in coding sequence

hi1321 is in the 2nd exon, in the 3' UTR

 

ATGTTTCTGGAGGGAGAGCGGATTATGAACGCGTTTGGGCAGCAGCCGTC

GAGCCAGCAGACCAGTCCCCTTCAGCAGCAGGACATCCTGGACATGACCG

TGTACTGCGACTCCAACTTCAGCATGTACCAGCAGAACCTGCACCATCAT

CAC

hi3747 (5-3)

CACCATCACCACCACCAGAGGCCGCCTGCGCATCCCTCCAGCTACGGGCT

CGGCGAGTACAGCTCGCCGAGCACCAACCCTTACCTGTGGATGAACAGCC

CGGGCATCACCTCCACCCCGTACCTCTCAAGCCCAAACGGAGGCTCTTAT

ATCCAGTCGGGATTTGGATCCAACCAGCGGCAGTTTCTCCCTCCTCCTAC

CGGCTTTGGAAGCGCGGATTTGGGCTGGCTCTCCATATCAAGTCAGCAAG

AACTTTTCAAGATGGTCAGACCGCCGTACTCGTACTCGGCGCTGATTGCG

ATGGCTATCCAGAACGCGCAGGATAAGAAACTGACGCTCAGTCAGATTTA

TCAGTACGTGGCTGACAACTTTCCCTTTTACAAGAAAAGTAAAGCCGGCT

GGCAGAACTCTATAAGACACAACCTGTCATTAAACGACTGCTTTAAGAAA

GTTGCACGGGATGAGGATGATCCTGgtaagttttaatgctctttatccta

tttatgagatgattacgcacttagacgtacaattacgcattcacaagtac

aattacgcagtgtatttgtgcttacatttctaattcatatcattcttttt

tttaagGGAAAGGAAATTATTGGACTTTGGACCCAAACTGCGAGAAGATG

TTCGACAATGGCAACTTCAGAAGaAAGAGAAAAAGAAGAGCCGACGGAAA

CGCGATGTCTGTGAAATCCGAGGACGCGCTTAAATTGGCGGACACTTCCA

GTCTGATGAGCGCGTCTCCGCCGAGCCTCCAAAACTCCCCGACTTCCAGC

GATCCCAAATCCTCTCCCTCTCCGTCCGCGGAGCACAGCCCGTGTTTTAG

CAACTTTATCGGTAACATGAACTCCATTATGTCTGGAAACGCGGTCCGAA

GCAGAGACGGCAGCTCTGCACATTTGGGGGATTTTACGCAGCACGGCATG

TCTGGACATGAAATCAGCCCTCCCTCAGAACCAGGCCATCTCAACACCAA

CAGACTCAACTACTACTCAGCATCGCACAACAACAGTGG

hi3239 (5-3)

CTTGATCAACTCGATCTCCAACCAT

hi1359a (3-5)

TTCAGCGTCAACAATCTCATATACAACCGGGACGGATCAGAAGTTTAGAG

AGTTCATCAAA

approx hi1321 (3-5)

CCTCTAATGTGTGCTCTGTGAGTACATGGACCAGCTGTAGATCATGTTTA

AATGCAGTGTGTGTGTGGACTTTGGATGCATCAGGCTTGGATGTGCATCT

TTTACATTTATTCTGTGATAAATATACAGTAGTCAACATTTGAAGCGGAT

CAAAAAGTTGTCTTTAAACTATTATCCAACACCCATTCTTGTCATCTTAG

GAATTTTTTGTGATCCTCTTCAAATGTTTACTACTGTAAATACATCTAGG

CCACTATAACAAGTGCCTTGTTGTTATTTTTTTTTGTAGTACAAATGTAG

ATATATTTTATTTAAATGCGATGCTTCTGATTTGTAAATAAAAACATGCG

TATATCTGTAAtatctagcattttttgtttcatttgtctcatattagcac

tgtttcaagactcaaaaagggcatataaagcagaaaatagttctttagat

gattattcacgttaaggaagatgtgtttcttcttaaagctggcattcctg

tgcaaaaaaacactcatttttgaagtgtgtatgatgagaaaaacatcaga

tgcatgtcaacacaaacacctaatgcatctcagtgtgtttcccacgcagt

cagcgggtggttgtggagatgcaagacactgtaacagcaattaagacatg

tttatgcagtttgtttactgctgcatgcaattacatatagcttgtttgca

tatgatgcaatcaaaaaggacaacttttaattcgctttttaaaataagct

gctgttaaaccaaagcattgagatatcagattgcacattttgattcatgg

ttaagacgtaacaaaaacgtacattttaaagtaatttaaccagcccccca

tctcttttcccccataacagatcaactccagcaaacatattgagttgaca

attatttatcaaaagaatttcaggtttaatcga