baculoviral IAP repeat-containing 5a (survivin 1; birc5a)

cDNA: Genbank NM_194397

 

hi3018C is upstream of the start site

hi1326 is in the 2nd intron

hi2111 is in the 3rd intron

 

aggtaaccaggatttttttttatatagtgcatagtgtgtgaaagagataa

ataaggagagaaacaagtgctttcgtgttttttctacagaagtcagtc

hi3018C (3-5)

tatgttagaagacaagtaactaaaagaaataacaataaccgtctgactct

gacaacaactaactacatgctgtggtcgaactgcgcatgcgtggttgtgg

cgCTTTGCAGCCAATCAAAACCCGCGCTTTCAATTTTAAACTTTTACCGC

AAGAATCAACAAGCAAGCGAGACTCCTGCGGATTTATCTCGGTTGTCTTT

TGTTTAATTTCCACACCAACCTCCCACAAAATGGATCTTGCAAGTGATGA

TCAGACCAAAATGTACTTTTACGAGAATAGACTTCAAACATTCGTCGGTT

GGCCGTTTGAAGAGGGCTGCGTTTGCACTCCAGAAAACgtgagtaaagac

agacactaggttctgtaggcgtaagttaacaaagaaatgtgttttataca

tgttttcattgtttcttagATGGCTAAAGCTGGATTTATTCACACCCCGT

CGGAGAACAGTCCAGATATAGCGCAGTGTTTCTTCTGTCTGAAAGAGCTG

GAAGGATGGGAACCGGAGGATGACCCTGAgtgagtccgtgtcttttaaac

tgcccactattgcattatacatctgaaagaagctttgtctctttaattca

approx hi1326 (3-5)

atgagactccgggtttatttgatttaataaatgccatgggtccccttgtt

atttcgcatttgttcctgacgtgctgtgtggtttgttgtgctgtcagGAA

AGAGCATAAAGCGCATTCTCCCAGCTGTGATTTTATCTTGCTGAAGAAGA

CAGTGGACAGTCTGACTGTGGAGGAATTTCTAAAACTTCAGAAAGAGAGA

CAGAAGTTTATTATTgtgagtatgacatgactggcagaacgttttaaagg

gatagttcacccaaaaatgaatattctgttatcgtttgctcaattacttg

cattgcatcatttacttgttttaaatctt

hi2111 (3-5)

tatgaatttctttttttctattaaacacaaaaaaaacaaaaaagtaatag

ggttagacaaaccatatatttttttaccaacaacacacgagcctctccta

taaatgagcactgaaagtattatcaccggacctatggtttctgttcagta

tttccaaaagtgccaggagtaaaaattgtactatttaccccacctacggg

gcaagttgtaacaggcagagggttagttataacacatgcttaaatgggca

gatttcacacaatcaatttaaatattagctatatttcctcagtacttagc

ttattttttattctacattgcacagcatggttgtttatttgtctatctat

tgaataatcagatttagatttatttgtattattatccattattatacaat

gcatttatttgtattattagcaataatatatactttttctattaaaaacg

ttttaatataaaaagttccccgcattacactaaaaatttcaaagtatttt

gttggtttagttgctgtccaacagtgtgtggcttacttgtaacaccctgt

tacaacaaacccgctgttttgtgttttcctcaaaactggcttgcagtcac

tgtgttttacatctttcaaaatggttccattttgtttttagcctagaaga

tgcatagatatatatattagatgttgcctggtctattgttgtctattgga

cggaatgcgtcaatagcaccgccatcttgctacagggtagcactccttag

aaatgaatacgggaccaaggtacggtggaggactgtggcaatccaaagcc

agatatgcacatatacacatatatctatgatcgggagatct

 

approx 3.2 kb to next exon (last exon)