utp15, U3 small nucleolar ribonucleoprotein, homolog

cDNA: Genbank NM_199704

 

hi1370 and hi1386 are both in the 1st intron, before the ATG

hi3632 is in the 6th intron

 

ttgttggtaccagaggtcaggggggaatgtcaatggttaagctgataaaa

acacaggagtaaaatgtctacagctgtcactgaatgcacaaaaacatcca

atttaaagcagattatcaactacaacagaaaattattgaggtaaagttct

atattcgcacatttgttcattttaacggtccctatattgtttactatgct

aacttgaatattcgagctaaaatcacatttaactatgacttcaaaacatt

atcagcattttaattgactgtgaacaatgttatatttagatagtcattgg

ctgacaaaataatttccctatttagaatttgcaaataatcaaatgaaatt

attttattaaggagaaagtctgattgtgcgaatataaaaccaacgttacc

taagcttgaataataactgactacaatctcgtattaaaaccaagtcatta

ataaaaagtgcgaagaaaaaaagagtctgactgttacttgtttttgcaaa

tatgttaacctagaaaaaagagatgtatcgcttgaaaaggccagagcaaa

ttgctgttttcatgaatatcgataaagtttgttgaaaaccggaagtgtgg

cGTCACAAAATGGCGGCCTCCATGTGGATGTAAAATCAACgtgagtttgc

tcatgttttcaagtctgataaaaatcttacagtaactataatcaatttaa

ctattttgggagctcctgtaaggtaagaaatcccttataatcgttagatt

aaaatatatggtttcgtgtaaaaagctcaacttgtcactttaaagtgtgt

attgctgatggtaacgttagtgtacgttgtaaaaacatattaacacataa

acgatttgtttagcatatatatcatcttacagactttgtggaaacgtttt

acgcgcccaaa

hi1386 (3-5)

taaatgtatcggaaagtaaagcgtatttacgtttgcacgtgtttagcaaa

tgagctctgatagtgaattatttgttttgggtttattttcccatttatta

ttcattaaaatcgaggtaaagttggttt

hi1370 (5-3)

tatattcgcacattcgttcagtcccaacttgtcacatgccccctgtattg

tttatcatggtactttgaatattaggttgaaaatctcatgcaagtatgat

ttgaaacacaacattcacaccataaactgactgaccagtgttgtactttg

atagtcgctggctgcttgtatatttcccccatatagattatgcaaagaat

tctttataaaattaaataaaaaatcagaaagtcttaacgtgcaaatataa

aggcaactttacctcaatctcactaaacaggtagtgactaaaaacttgaa

tgtaccttggcagaagtgttcaaatgttttcttatggcgggccaaaaagt

gaacttgatttagggctgtgggacgaaggtaaaaatatcaaactgtatta

cattaaagtttccatgattaatttccttatttatttcataatatttaaaa

gtaactacaaaacactgctttaaatttaattatctaatgcagtaagtagt

aaaaaaaaaagcctgcgtaccacttgtggtacatgtaccacagtttgaga

accactggtctaaatgataaaaaatatacgttaattaaaacacagtgttc

aataagggttaagtcatttttctcactttatcatgggctgacagtaaaga

tcatctcgctgcactggttagagattcccaaacttttttattgaggtaaa

attcttttctgtttgcacttttgtttagtgacaacttctgacatgctcct

tatatcgtactttgaatatgctgtaggaaatctcaagcaagtgtgacttg

aaaacaacattagcactatttaattgactgaacaacgtactttgatagtc

atcggctgcttatatgatttccctatttacattatgcaaataatactttt

ctgaaattataatattgaaggggagaaagtctgaatgtgtgaatataaaa

ccaacttcaatcctaaactgctgtggttttatctattcagGTCCTCAGTG

TGAAGCTGCTGTCGGCTGAGATTCAGTGTTTATATCTGCGATGGCTTCGT

TCAAACCCACCAAAGTCCTGAGCTATCCTAAACTAGGAGAGAAAGTGACA

GAAGAAACACTGTACTGGAAAAACTACAAGgtttgatgtgtgcccgacaa

cttgttttcataatgaatgtgtatatcttgggtgttttgaaaggacaact

tcttttttaattctttctgtacactggttttgatgtcagtctgttttttt

taaagCCTCCTGTACAGATTAAAGAGTTTGGCGCTGTATCAAAGATCGAC

TTCTCTCCTCTTCCACCTCACAATTATGCCGTCACGGCCTCCACCAGAgt

aagtacaacctctctccagtacatgcattcattttcttgtcggcttcgtc

cctttattaatccggggtcgccgcagtggaatgaaccgccaacttatcca

gcaggtttttttacgcagcggatgtccttccagccgcaacccatctctgg

g

 

much later in gene

 

aatcgctttacatttatggatcatcatatatttggtgttatgcgttgatt

ttccctgtacagttaatgtatgtacagttggtgatgtttatgtcgatgtg

cacagttgttgatgttggtctctgttgcagGTTCGTATGACCACACAGTG

AAAATGTTCGACGTGCGCTCTGGAAACAGTGTGATGACAATGCAGCATGG

TCAGCCTGTGGAGTGTGTGCTGCTGTACCCGTCTGAGGCTCTGCTGGTGT

CCACAGgtgaaaaacactcactttttatccaaacatgcaaattagattta

tgaacaaaactgaaatatcacataaaacatttgggaatgaagcagcatat

ccattaatgagtcaaagagaacaaaacattcgtttcatgatagactcctg

ccaaatatttatataaaaaacttgctgcggtagtaggaaagccaccgcct

tttttcttatataataaatgacttttagag

hi3632 (3-5)

gcgtaaccgctttttgggagcacagacgttcaagacaatcctggaggtag

tagtaatataataataataattataaaactgaaccactttgatgatagac

tttggctgagggatttaaagggccatgaaaccccctcgtttcagcagggt

gttttcacacctctactttggaaaaagtcagaaaagtgggcgtgtccagc

tctgtttaggggggagtgtcggaggaagaaaagaggcttggtgtgggagt

gtctatttggacgcgctggatttcagagtcaaaacacacacacacacaca

cacacacacacacacacacacacacacacacacacacacacacatagggg

agaaagggactgtgtttacatggacatctgtagtcg

 

approx 4.3 kb to next (7th) exon