U1 small nuclear ribonucleoprotein C

cDNA: Genbank AY099526

 

hi1371 and hi3936 are both in the 1st intron

 

CTACATCCGGTGGTTTTCGCCCCGCGCTGTTCCGCTGTGAAGATGCCGAA

gtgagtccgtttttatattatattacacaattaatagcacaattcataag

caaaacaagcaagcaggtttactcaaaaaagacaatacgtgtatcattca

tgcgtgcagttttgcagtgtagatttctaaactaactacatttgttagac

aagagctagctctgtaagctaactaaagtcagcttttaaatgtgtttagg

atcattactacggcacttctgttatttaaacacgattttaacagctttca

gtataatttacggaaggaatacacatttt

hi3936 (3-5)

aaggttacaaattaatcaactaacaata

approx hi1371 (3-5)

ggcttacataaatatgaacacaattttacgattctctgccttgaaatgct

attaaaaataaaatattgtattatttctatagtaaatgctgtatttagct

agttagaggcagttattgttcgttaaatagctataaaatacatgtgtaca

tttgtgtttagcttttaatagtagtgtttgtctctttcagGTTTTATTGC

GATTACTGTGACACATACCTGACACATGATTCGgtgagattaccacttca

aacctgtgtaaaatgacttttatcattattatctgcgcaaatgtttaatg

ttgtagttttatgcctgcagCCCTCGGTCAGAAAGACACACTGCAGTGGA

CGCAAACACAAAGAAAATGTGAAGGATTATTATCAGAAGTGGATGGAGGA

GCAAGCTCAGTCTCTCATTGACAAAACGAgtgagtaaattatgatcatgt

gtttatttatcaaggtgtaaaagctattcttgatgatataaactgtcttg

ataattaggcagggatgtcttggtagttagagatgagtgctcctgtgtaa

agtcatttttgtctgtttttgcagCGGCTGCATTCCAGCAGGGTAAAATT

CCGCCCACCCCGTTCCCTGGAGCCCCTCCACCTGGCGGATCCCTGCTACC

TCATCCAAGCATTGgtgcgtttcagagagatataatgaattatttctatc

ctctcatggccattgcagtgtttgcatatttaaaataatatttcagaaaa

ctaaacagtttttattcttca