PHD finger protein 5A

cDNA: Genbank AY099533

 

hi1373 and hi3245 are both in the 1st intron

 

tcgacatttgagctttctgactcctacgtaactggagtttttttacatca

taaaattgtaatccgttaataaatattaacgttattgtattttatatttt

atatttatacttgaaatcagcagctcctctggttatcagtctataaacat

taggcaaagagcatagaatctgactgaatctggtgattgtaagctctttg

cattaggtggcagtaggttgctgcgcatcttttagaccaaaatatccgaa

gaaGAAAGTTCGGAGGTCAGCGCTGCGTCGACGCTTGCTAGCTTGTTCTC

TGCGCTCACTCTTTTATAATGGCAAAACATCACCCAGATTTGATCTTTTG

CAGAAAACAGGCTGGAGTTGgtaagtctcgtttttcattagaccttaaat

aatttctttgtttaatgatccaacttatagcaaacaatgagtgagaatgt

acactcgcgctacagcagatggatgaacaata

hi1373 (3-5)

aggtttc

approx hi3245 (5-3)

aatctaagtggagacggttcaattaatcgtgtaactttagtaagcagata

aaatagcagccttacaaagtcctcgtatacgatgctagttagtcagatat

ttgattggagaaataacgatgtttaagtgtttgtgcgagccgatgcaaac

gtgcttttgtcgtttgtttacagcgtcctcagtcgttggagggcggaatt

gtcatgcaggctttcagatacttataaagagaaagagacaaaacttcact

ttactgaccatcaaatggttccaaacctttgaagttttctgttgaactca

aactgttttcgtagcgtgttgggaaatacaattaaaatagatgca

 

perhaps >300 kb to next exon