heat shock protein 8

cDNA: Genbank NM_131401

 

hi138 is 350 bp upstream of the gene

 

gtaaccaatgatttggcccaccaccccat

ctaagaatgatggagagggatggagtgaatgccttcgacagagattgtca

tttctaatttgaagtaacctttttgtgtcactagtgtacctccattctgt

tataaattagattttgttttgtttttacagtaataagatataaaatgtaa

aatatatatactctattggttataataaagcaatgttttctagtaatttg

taatattattaaataaattaggaaattacccatgacaatcatttggctta

agcccactagccttaataaagtttggtttttggcctttcatagtaaaatt

ttgagcacccctgatctaaaagatcaaatatacgcatgtttgcacctata

ctaacttctaatattttacatttctcttgattgtctgactaggtttttgg

aactcaaactttacagtatacaaagtagaagaacctcctcaaaacaccac

agtttcagtcgctacaatagatgtgatcaacgaagcacaagacaattcca

aaacggcttgtaaccaacaggacaaagcttgtgcaaggagactgaacttt

agaggaacgttgaaccctcaaaaccctgaactgattttgcagttctgtta

tgaactatggtgctaactcacttagcctgtttctgtgaacattaaagctg

atagctgccgacttttgtatgtaatgtacagtgtactgtatatccttttt

ttttaactgttgaaggtttacattattttttatacagaatgtaaataaga

gtttattttataatgtttgctttgttatgtgtttacaataatttgataac

cataaaatggttccttgataaaattgaaatgtactgccatggtattttat

tattatagattaataatgaggaatgttaaattggtgctgctctgttctgt

tttcaataaaacatttaataaggcattgtgttatgtaatgtatgttgtgt

gtgaatcttctagaacatagaaaatcgtagctaaatgaaagtgaaacaac

ttaaccatgatcactgtctttgatggcacgtaggctagtgttgtgcccat

attatttaaaaactgagatatttcagcttgatgcactttaaatatgagtt

ataatttatatatttaatgtgactaatgtgagcagctttgctacttcctt

gttagcaacatatactttgcgcgcagtgccaccttccgggtaaatgtgtg

atcatttctaataattgctattttctttcaattcttttcatagttttaga

tattttccataaaacaataaatagatgttaaaatgtaactcatcgtgaat

gtaaaaatacttcaccagggctcagcgattggttccatttcttcaacacc

gaatcaaaagccattcgtgatggcagtggttgaaaagtgtgtttttacgc

atttaaatacaatattaaagttaaatatatgaatatgagctctatgcgta

ctgtaaatgcaaacaacaccttttatctcgatgtttcttcataaatgatg

acttgaatattagagacctttgtgtttcagaccaaggtcaccgagctatt

ggggcaacactgttatgaagtt

hi138 (3-5)

atatatgtttttcatggcgttagcaaatacattttcgacaaacgtttatg

ttttgctgtatcactgacgcttttccagtgaacgtgcagggtgatttcat

tcatacagcaggacaaactgttccgcattgacagcggttgcggcaaactt

gagggggatggtttggatttcttgtgcaaccaattatattcttcgttttt

ccttagtaggtgtggtttaatgaagtattgcattttttcattggttcttg

tcggttgaagtcccgatccttgcaatctcattggctccgctaccggcaat

ataagctgttctagaacattcgaccgtcctcttattgaagcaaggcgagg

caGTTTGTCGCCATTCCAGCTCTCCAACCGGCATCTTCATCCATCTCTGT

TTTATCAAGCTTGgtaagtcctttgttctctcgttttcgactatgtactg

tttactgtaattcatttcaaatcatcaatttattatggaactatttccaa

ctaatttgatattagattgggttttaaaagccaa gttttttttcttttaattatagaatgtttttttttcaagattaaccattt

gtaatcgtttcctaactgaagttgtataatgtatccacaccgtttataag

tttccgagtttgttaacgttatacaatatttttccctcaccttttcactt

tatggaaaaattatctttttaaattttaaaacatccgaaacattaatgta

tttcagtaacgttatttcaaacaaattgtctgagaatactgaatttaatt

tgaaaccgaaatcgcctcctcgtgtaatctcatcacgcgcctcagtcgac

agtaacgttaagccttgattagagacttaaataattacaataccggcttt

attacttcatgttattgcgggtatggtgcttcattgtacactgtgaagta

gcattttagtaagtttttacctttatgattttaaattctccagtttgacc

gtagaacgttctagaagcgcacaccacgtggtctgacgcacatccgcata

tgctccagggtgtgtgtgatttcacaatagtatgttagctggctaataga

catcctggttgttctgttcatctcaacactgaattccctttaattattaa

ttgctttttcccctcctctcccacagACACAATGTCCAAGGGACCAGCTG

TTGGTATTGATCTCGGGACCACCTACTCCTGTGTAGGTGTCTTCCAACAT

GGAAAAGTTGAAATTATCGCTAATGACCAAGGAAACAGGACCACACCAAG

TTATGTAGCTTTCACAGATACTGAGAGATTGATTGGAGATGCCGCGAAAA

ATCAGGTGGCCATGAACCCCACCAACACAGTCTTTGgtatgtacttttta

atatttttcccaaaaattattcgctatgatgaagtttattccttgccatt

cgtagtttccaccagaggttgaaaaaccaaagatggcccaagtaccttcc

ttggatgtctgagcgaaacaacaattttgtatacgagcctgtcaatacag

atttagaagccctctaacttgtatatgcatgtttgtttttcaatagATGC

CAAGCGTCTGATTGGCCGCAGGTTCGATGATGGCGTTGTTCAGTCTGATA

TGAAGCACTGGCCTTTTAATGTCATCAATGACAATTCCCGTCCCAAGGTC

CAGgttgaatacaagggtgaatccaagtccttctaccctgaagaaatttc

ctctatggtcctcaccaagatgaaggaaattgctgaggcctacctgggaa

aggt