nicastrin

cDNA: Genbank AY751744

 

hi1384 is in the 1st intron

 

tatcttaaataattgatatattgtttaagcttttagggtaaaccaaactt

gttttccaagtccttgttttttcttaaaaaaaaaacaagtttcccaaatt

aactggctaagcttgtgttttgacccctgaacagtggaaatttgcttgat

aaataacaataaacttttcaaaaagacatgtttcagtgtaatggttttgt

tttgcaggtccttctttttaaatactttcccaaagtaattagttaaggtt

gtattttgagccctgaacagtggaattgcataaatacataacagtaaaca

tttttaaagtcatgtttcagtgtaaacagattgtttttaactttgtattt

aaggctagtcagacttagctacaattgtgtttaggctaacttgctaaatg

ctaagttttatctttgtgttgtaaatgaatgtaaagtgagcacagagggt

taaaataacttcagactgagtatttgtgtgacagaacggcagttgtgcag

aatctggagatgattatcagaatataaaaagagatcgtcaggaaatgttt

attagcaaagtgtccttgcagtagcgcatttcctccgcggctgtcgctgt

gctcaatcacctcaaacgccgaacaagaaaaaccggaagcGGAAAAAAAC

AAGCACTCCTTCAGTCTCTCCGCTGATCTGTGAATGAGGAAGATGGAGAA

TTTAATATCAATAAACTGCGTTCAGCTTCTCATTACAGCGCTATTTTACA

CATgtgagtactcatattatcgtttattgttgaactgagtgcgtgcgcgc

tcacgagatcatcaatactgttgtctccctcaggcctgaaacataaataa

actccccggtaaacagtcaaaaacatcattattttaggaaagtaccgcga

tattttacctttttattacagtaagttgttgaacatacactgtttaatta

gtgactgaacgagtgttttggtttaatgtcagtaacacaaga

hi1384 (5-3)

gttccttcaagtaaatctttgtcatgtgaccaaaacagcaggacagtctg

gagaaataatgagaaatattaataatagagcaccgattctgacctgaagg

tgctttttacacttttgaaagattcaattggggagtttaaaactcatcta

acacaatgtaagattactttatctttaataagagtccttatttacctgga

aactcttttattgtatttactgaacgtctcttcgtgtagattagccatga

aatattgttaatgcactaagaggatgaatagaggtgcagttgggttttat

attcggatattaagacattctccttaataatataatttcagaaaagtatt

ctctgcgaattttaaatagggaaatcatattagcagtaaatgactatcaa

agtacagcactgttcacagtgaattaaatagtgttagtgttgtttagaag

tcatacttgcatgcaaattccgatctaatattcaaagtaacatcgtaaac

aatatagagacttctaaatgaacaaatgtgtgaatataaaaccaacttta

cctctacagaagatgatataaattcagtttttgcaaatgatgtatgagtg

tgaattctgattgaggtaaagctggttttatattcacacattcagatttt

ctccataataatgtaatttcacaaaagtattatttgctaattataaataa

tttaaaaataactttctccataatatagagacagttaaaatgaacaaatg

tacgaatataaaaccaactttacctcaatatgtgacaaatatggcattac

aaattggagaaataataagaaatttcatttataaagcactgattctcatt

caggcctctggaaaacagcaacgtaagattgcttcatcttaaataagagt

ccttatctacctggaaactgttttattgtgtttactgaacgtctcttcgg

gtaaattagccataaaatattgttaatgtactaagaagatgatctaaatt

ctgttattgcaaatgatgtatgagtgtgaattctgattgaggtaaaactg

gttttatattcccacattcagactttctccttaataatataatttcactt

aagcattatttgctaattataaataatgaaatcatattagcagccaatat

caaagcacaacattgtttatactcagttaaatagtgctgatgttgtttta

atgtcatacttaaatcagatttctgaccagatattcagaattaacctggt

aaacaatatagagacagtaaaaatgaacgagtgtgtgaatataaaaccaa

ctttacctcaataatggacaaaaacagctttacagactggaaaaattata

agaaaaatcttttatagccctgctgaaaaatctagcttaaaccagcctag

gctggttggttggttttagctg