cadherin 2, neuronal

cDNA: Genbank AF418565

 

hi1389, hi3096, and hi3644 are all in the 2nd intron

 

agagcgtgatcgttatgtccatcgattcctcttgggattcgggatatttg

gctctcgctgtggtgtaggttggcccacgctgaggggcgatgtgtattaa

tcaccattaatcgggggattaatttgtctggtgcttttgtgtttttggca

gGTGGCGGTCCAGGGCACAGGGGCGATGCCATGTCAGCCTGGTTTCACCG

AGAACGAGTACAACGTCATGACAGCCGACGTCATCACCGAGGGACAAGTT

CTGCTCAAAGgtaaacaaagacgttttctttacatgcatacttagaataa

acggaccaatccaagcggtgaggcagagtgctcccttaccaggcttgggt

ttccagtgtgaagagaaaaagggttgggggaagggtgggctttatgcttg

tatgtgaaagaacgagagggggaggagggttaagtgttagggttgcttta

gtagggggtgtttatagagggtgatatgtgtgcgagagaaagaaaggagc

aggaggaggagaacagctctgtgttttggtggaatgtgttttgaagcttc

acagtgtgaagtatctgggtgcttgaatcaccctcccccactgtggatga

atccctgttgtgatcgatagcattgattagaccagcccatatccatacag

ttagtcgatggcacacatcccagtcagccatctcaatacgctcagtcaat

ccggcaggggccacatttgtgctgcggttgtaaacttgggaggccttata

acatcccagcgtcacgtttaattatggtgccataaaaagggcataacgac

ttgttttacatttccagtagattaacgaaaataaaccagcaggccatggc

tcgtgattcagtcaagatattttatagcaaattcaagaatgcgtcaaaat

gaattataacaaaactactaaattaattatcgaaacaattgaatttggtc

attaagccaactttagaaatgatgaaccagaattatttctaatgaaacat

tttttgctttatttaattttaaaaactgaatctaaatatataataacatg

ttaactatagctctggtttcccccacagtctaaagacatgcggtataggt

gcattaggtaagctaaattggccgtagtgtatgtttgtgaatgcaaaatt

gtatgggtgtttcccagtgttgggttgcggctggaagggcactcgctgca

tcaaacatatggctaagttggtagttcattccgctgtggcgacccctgat

taataaagggactaagccgaaaagaaaatgaatgaatgaattttaacttg

aaatgttgttcattgagccagtcataatacagtgctaggcaacaaaccat

cttttagcgctatcatgtatttattcaatattttagttaattaccaaaac

tgttttaattttaaaaatgagtaattaattgtggataatttcactcaata

tgttgtgtattaaacccgtcatagtaatgtgttttcggaacaagctgcgc

tatagaaaaagttaggattacttgaaggattttttctcacaaattcagtt

aaacacatttcatgtctattctactatcatttttggtcatatgaagtaca

tctactctaggcatggcttaataaaagattgtgacggtatgataaccttg

gattaaaacttcacgttttcacggtaatgtaattactgctctaaaaaatg

tttttttgaatgtctgggtgaaaaaaaacacaatatattttatcttgaga

aacatttaaagcatttttggaacagtgaagatgtcaagctaaataattca

aatgaatctttgacttctgctgcgttcattaaaatgtatagatttcttaa

caatataaaatggcaattttggatatctttcctgctggagatactgttgt

cctaaaaagctaaaaaaaaaaaaaaaagtcttatatatatcattggaatg

gtataggaggtggttttaaaaccttgacttctccaagatgcggtatacct

tgaaaatggttatcatcctatgcctaatctacacaacagaaaaaaaggaa

caagttgagtttacttacaaaacatgtggaaactgattgccttgaattta

tgaagctaatcagttcacaaacgttgagtaactattactattactttgtg

ttggtaacttgtttacttggttactaaacaacgcgagtactgattgctca

atgtgatgagttcagttaacttagaaattgtagttatgcttagcacgcct

atcttacagcaaagcagtattctcaactagcctgcttggttatattgttc

hi1389 (3-5)

acatcaccaactttgagtaaaacaactaactattactttgtgtaggtaac

ttatttacttgtattggttactagactgcacacagtactggtgactcaat

ctgccctaaatttctcttgaactcagacagaaaacctgactcctgactag

ttttttgccatttaccattaccattaccattttatgttagtcggttccac

ataactgagttaggttgcgtttaagtaacaatatttttgtaaacttatgc

taattgcatagtaatgcaattacgatgagtcgagtcaatttaacattctt

gatttgttgtattttatcagcattttttgtgtgaatcaggcatcaagtta

atgtttaaacagacagcaaaagcacctacaaaagaaaagatgttacttta

tgtttggtgttgtcatcatgacaaaaaaaatcaatggccaaaacaaaata

ataaaaatcagtcaaacacgtcctcagagtgccactgctcaaccagcttt

gtcagaatattttagcctgcagattgaatttttgtgcatcacaatatttt

tgtcccaaag

approx hi3096 (3-5)

agccaaggagttgcttttttaactcatttgttactcagcttctagtaagc

gacatattatttttacatttccatgtcattgacttattcatgagctaccc

tggaagagcaagcggtggaatacgaacagacggtcgtaagctgtagcttt

aagcctcttgaggtctatttgcaaactgtaggacatgcacacacacacac

agacctgtgacaat

approx hi3644 (3-5)

taaaataaaagtgataacacttgctttaaatttcacacagagagtcgaca

tatcacaccctgataggaatttccagagtgtgtgagttgtttgtgagtgt

gtgagtcaggagctgctgatggccgagttgtatcacactcacaaaaaacg

gtcatttgatctcacggtggactcactgattcacttcctgtgtccttttc

agtagaaaggtgagctgcgtcgcactggccacacggacacaaaagcagct

ctcatttcattaccattccggcctgtacggttaccaagtcaatgtgaact

ctgtgctttttttttctgccaacagacacaaaaattcgcttcccgttatc

ctccctcccccttcactccttctccatctcaccccctcctgactgagcac

cgggggagtctcttgttaaacatgaggtggatgtttgtgtctctgacatt

cattcatcacatcctttttaggcaaatgacttagggatgaagactttctc

tactcccctgcag

 

approx 4 kb to next exon