MGC35261-like (twister)

cDNA: Genbank AY618927

 

hi1392 is in the 1st exon

 

agatcttgttgaggcgtcttggtgttagccaatataaagcattttaaacg

cagacaagtctaatgaaaatacaatgccaaaatatgggtcaaatattatg

taagtgcactatttcataaagattaagcaacatgatgaatctgacctgta

ctttttcaaatataaactgatcataccgaatttgattacattttaaacat

taaaaacttgaaaatacctagaggtttgaaggattttggcaaaaactggt

taagatttaaaatgaattttaataagggcctacattggagctgaactttg

agccggaacatagcatgaaataatgttatataattggtcataaaatgatt

attattgtaagcatttctgacaataattttaataaacaaacctttgttat

cttaaatatgtcttttgctagagcgacagtggctcattggttagcactgt

cacctcaaagcaaaaagattgctggtttaggtcctggctgggtcagttgg

catttctgtgtggagttttcatgttcgagtgggtttcctgcgagtgctcc

ggtttccccccctgtccaaagacatgtgctatagccctaggtaaattaga

ttaagttaattggccgaatgagagagtgtgtgtgtgtgtgtgtctgcgtg

tgtgaatgtgatagtgtatgggtgtttcccagtactgggttgcggctgga

agggcatccgttgcataagacatggcaacccctgataaataagagactaa

aggaaaatgaatgaataaatgaatgttttgagtgagtctattatccttgt

tgttggttctccctgtgtttgcgtgggtttcctctgggcgctccggtttc

ccccacagtccaaagacatgcggtacagatgaattgggtaggctgaattg

tccctagtgtatgagtgtgtgtatgtgtgtttgtttcccatagatgggtt

gcaactggaagggcatccgctgcttgaaaacgtgctagataagttggcgg

ttcattccgctgtggcgatctggattaataaagggactaagttgacaaga

aaaggaatgaatgaatgtcttatggtaatcttaacaaaaatatcgccatt

cataaaaggcatcaatacaccttttctttctacgtatgtaatagtctcag

gcctgcaatatgcgcaagaatgaccaaccccgccatctagtgtttggatt

gatctgcaacaacatacgtgcaaaaacggagtatatttctaacttaattt

aatatttttcgttattatatgtatatatgttatatgagttacatgtaaat

ccatttttaaacacactttttcatacttacaaataaacaactgtatattt

acaaattacatcgatggtggtttgttaaaatacacccagaggcctagcaa

cagttactactacaatccgcgtccatggaaacgctaaacttAGCACCCGG

AAGAGCAGGACATTCACTTCATGCTAACGCTTTACAATAAAAAGAAAGAA

CATTAAAAACTCTAAAAACACTTACTTTTTCGTCGAAACCTCTCGAATAA

CACAGATGGAGGGTCTCGCGTCCGTTCATGATCTTCAGGCGTTGTCTGCT

CTGCTCTCCAAGC

hi1392 (5-3)

CAAAGGATAATGATGAGGAAGAAGAGGACCTAACGCTACAGgtctgagct

tcaaaacagctgatgatttatctattatcgcctgacaaaccttgcatttt

attgaattcttttttgtttttgtgtgaagCCCATGGCGAGGATGGGGCCG

GGGCATATCGGCCCTCCTGCTGCACCTTCAGGAAAAAACAATGgtaacgt

tataattaaatgatttaatttaaaactgtaacgttaccactttt