eukaryotic translation elongation factor 1 gamma

cDNA: Genbank NM_173263

 

hi14 is in the first intron

 

aacgcaaaagcttttgtcgggcagggacaaatctgttttcaaaatacttt

ttatagtagggaaaaaacatttaaaatataatgtgtttattattggttga

gaccattgtaaacaaaggttaagcaattttaatatttatccatgttttat

aggcaatttcgctgatgctcccaaataaattaagtggggcacgtccagct

ctcactttgacacccttactgcgttttatttctgcgaccgaacaggccta

tacgtcaccagcgcgccgctcgttcttcctttctctcGTCCTGAAGATGG

CGGCAGGGgtgagtaagatgggagaaaaccctctgacgcctgatatcagc

tcatctccatctgcaatcaccccataatcaccccaatccttatatctaca

catgttttctccgtttagaatgatttagtggtcttttttgtagctgttgt

gatgattatttctgttgtaaatactccccacacccctttataaggtggtt

agagtgatgacgggcagaaacagcgctacgctctttgtgccacgtttctt

gtttttcttacccctttatgacgctcatgttttgcttttttattttctag

atgacaagaggtcacggcatttgttgttagcttttaatttaggaaagtac

agcgcgtatattggctgactgaaaagcgatttgagttgattaacgagcgg

ttctcattaataagacaaacaagattttgtagtttagttaaaagcaccta

cttgtgaattttcttagtgtcaaaacacttagagattttgttagaaatta

agtttttaaagcttggtgccacccgtagattcataaataaatagcaattt

cagcccttcagtgtcttctggcaatattgattctctatttaaatatgcaa

acactgtttacacgctgagtgagaagtaatttattgcagggcagtttgct

gtcagctgtgtctggctgagggaaagtgctgtgtaatgctctatgagtgg

tcttaatgatggggcagcttctgttggcactgagtttgtgttacagaggg

ctgatgcc

hi14 (5-3)

aaacaagcagcatcagtttcagcaattcaatcttaaaccatgtttccgta

gACTCTCTACACATACCCAGAGAACTGGAGGGCCTTTAAGGCTCAGATTG

CTGCCCAGTACAGTGGGGCTCGTCTGAAGATTGCGAGTGCCCCCCCTGCC

TTCACCTTTGGGCAGACAAACCGATCCCCTGCTTTCCTTGGAAACTTCCC

CTTGGGCAAGgtcagtattcttttccttttccctgcatctgtttatatgc

atttttgcagaatgattatatgatatttttatgctcattcatttagGTTC

CAGCTTACCAGGGTGATGATGGCTTCTGTCTGTTTGAGAGCAATGCCATT

GCTCACTACTgtaagtaatctttattagagcctgtttgctattgatcatt

taacaggttttcttgtttagttatctgatttgattaaatggtattattta

aacatggtccctctttccatctgctaccagtatgttgtcattgaaattac

aatttttaaattacaaaaaaaaaaaaaacattactatgacttattttaaa

tttaccaacaaaatacattaatcctttgtctacttcaatggttcattgtt

gacgatgtgggtacctcacactaaataagattttaatgcttgtatactct

gagtgtctgcggggtcttaaagtattaaaagttgataaaacaatcatgag

aaaatgaagccctttaaaaattattcaagttataattgcgttttcgcaag

gtcttaaatgttgtgcaaagtgtttgacttcaaaaaagcataaatacatt

attttcctcctagtattaacaacggcgtgctggatccatgg