MCM7 minichromosome maintenance deficient 7

cDNA: Genbank NM_212569

 

hi2936 is upstream of the gene

hi1411 and hi3074 are both in the 1st intron

hi2704 is in the 2nd exon

 

ccatggcgatggctcagatgaggatgatgatgatattgcagattacagtg

atgaagactcagagaccggcatcactttggtgagtttcagcaggttcatg

acaagtagagtcatcttcatcaccatcctcatctctatcttcatcatcct

catcttcttctgtgtcccccacagccgtccactcacggctccacgagttt

cctggaggatctgtttgtgtaacgctgctggagcttcagtgtgtttatgg

cagcgtttgtgcagtgttcacctgttcagctgtgcgcgcgtgtgtgtgtg

ttcaggg

hi2936 (5-3)

caggttcactgagtgttctgattgaagtaaataaagcacagttactcccc

tctgtctcttgtcattgtgtttctacaccagcagatttcactgagctgtg

tgtgtgtgtgtgtgtttaagcagacagcagcactgatcctgttcctccag

tctgatcaggggatggcacacgcacacatctgctgttcctgccctctgag

ctctagctgtccccgcagcagctccggccattacagtttctgtcgttctt

tctcaattaatagttcgtcttgggagtttcccgcgcaacacttcctctgc

cgcggcggatgtttttaacttctttgttgtgacgtcacgttgttttaccg

ccgtttaaagagtTAAAATGTTCTTTCCGTTCACGTGACACCAGATTCTC

GCGCCATACGACGAGCCCCGCCTAGACGCTGCACGCTAAGCCGCTCTCAT

TGGTGGAGAGCCCGGACAGACTCGCGCCAGTTTTTGCAGCCACACTCGAG

TGTCTGTGCTTCAGTCTTCGGGCGGAGAATTCCCTCTGTAATCTAGAGTC

TTCCTGCGCTTCATCTCCGGGATAAAGATGGCCCCGAAGGATTATACGGC

GGAGAAAGgtgagtatgggtccggagaccaagcgggaccgagcatagcgt

tagtttgcgcgcttctgtcaaagttgcgcgtcactcaataaactgcggcc

cgcggatcatgaacagctatactgatgtgtgtgtccgcccgtgtgctgca

ctttacagcggctttacactgccttgtgtcggtaacagcgggtttactct

gctctgtgtgtcggtaacagcgggtttactctgctctgtgtgtcggtaac

agcgggtttactctgctctatgtgtcggtaaccgcggctccaccgataga

ctgctgtttcgtgagtttcgcgcgctctccgcagttcccggatggagctt

ctggacaaagagcggcggcgcgcggaaagcacgtgcttgatttcagagtt

cacgcgcttgttatccgttagcaataagagcagatctgtgccggggtgtt

ctcgcctgcacgcgggtggccggtgctgtaatgtacgtgcatgttaaagc

cttaaagcacggtgtgaaagtttcattgattgcgtaattaaccgagcgac

ccgaacccaccccagagcctcggcgcggtccgctaacagagttgggtcag

ggc

hi3074 (5-3)

taggttcgggttggtgttagtttagggttatccgtgttttttgcacggca

ctagtttgtccaacgcggagtgatccgcggaagcgcgcggctacggtgcg

gctcggggccatgtgcttctttgtttacaaaaacagcagtcatcgatggc

gttacacgcgcgtcacgatcaacgaaaggtaaaatcgaggccagtgtcgc

ctgtcggaccgggacacggactgcagagacgcgatccggtttatcgacat

gtttatctgaact

hi1411 (3-5)

gaagtgttttattcgacgcgaggctgttagacgcgtcgaagcttcgtcag

gcgtttgttcatccgcttataatgagcgcgtgaatgtgtgtaaacgcgga

taaagcggcgtttctgctccgggtttcgaggatttttgctttcattagtt

tgtttacgaacacgatcagtatcacgtgactactgtttatcagcgggccc

gcgcctctgcaacttttcacacacaccacataaccctaactaacaatact

gaacggtgagcgttttctgtaggagttttaaactgaggatggtgtgtgtg

tgtggtgtttctgacctgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg

tgtgtgtgttcagAGAAATGTAAGCGGTTCCTGCAGGAGTTCTACACTGA

GGATGACTCCGGGAAGAAGATCTTCAAGTATGGTGCT

hi2704 (5-3)

CAGCTGgtgagtgctggccggtgctgcacatctgtctgtgtgtgtggagg

tgtcgctcgctcacaggtgtgtgtttgtgt