60S ribosomal protein L9

cDNA: Genbank AY648736

 

hi1422 is in the 2nd intron

 

tcgaatcatttaagggtttctaacgttgctctatcgtttcagaATGAAGA

CCATTCTCAGTAACCAGACAGTGGACATCCCTGACAATGgtacgtcaaat

atcatacttaacgtttgaaactatttacacgtttgtgtctaaagcaacat

caatttcgtttttttgcttgcagTCACGGTGTCCCTCAAGGGCCGCACAG

TTACCGTGAAGGGACCCCGTGGTGTTCTCCGCCGGGAGTTCAACCACATT

AACCTGGAACTCAGTCTGTTGGGCAAGAAACAGAAAAAGgtttgtagctt

agttttgatatatgggcctgaaactgcattgtgtatcattcttggtggag

ttgttaaaatgcaacagtgcattattaatgacttataaagccttcatgta

cgttaaacatctgagctggtccagtcaaattcattccaaataaaatgtct

attgaattattagacataaaatgtctatctactttgcataatgc

hi1422 (5-3)

aactaaactaagtacaaaacctttttgagtgcaatttgacatttctcagt

gttaatgtcttttatattttggatgttttgcaagttcaatttcaagaata

tgaaatgaagtttaaacatttcctcccactctgcctgcaagctta

 

approx 1.6 kb to next exon