adenylosuccinate synthase

cDNA: Genbank AY099534

 

hi3081 and hi4042 are both in the 1st exon

hi1433 is in the 1st intron

 

tgtgaagtcacaaatgataagagccgaaaactttcaatttactaaaaatc

atttcaatagcttcatgtcttatgtactctgaatttacttcaataactct

tttacaaccacgcacgttctttatgtggagctttcatggctgcatgtgca

aaccaaagcacctcttttgttaacttttagcccccggacttttattgtga

atctgaaggccaatctcgcgcgcaattgtgtcggtaccgcgttcacgttg

ttccctcgcttagtttcagcatgGCAGCGGACAGCACAATGTCTAATGGT

CAGGAAACGGCGTGTCTGAACGGCGAACCGGCGCTCAAACGCTCCAGAGA

CAGTCTGGATTCACTGCGGGTCCCGCGGGAGCCCCAGAATAAAGTGACCG

TAGTGCTGGGCGCGCAGTGGGGCGATGAGGGGAAGGGGAAAGTGGTCGAC

CTCTTGGCAATGGACGCCGACATTGTAT

hi4042 (3-5)

GCA

hi3081 (5-3)

GATGCCAGgtgggtttccagccgcttatcattgtgt

hi1433 (5-3)

gttaaataagagttcgccgcggagatataatatctgctacctgagattta

gtttcattaggcaatgttattgatgtaagagcggaaatgcccgcgttcac

aagtcgcatctctaacctcacagggcgaaacaaagttttccgaattgttg

tttttgtcattgccacttgttggcggtagaactagtgatgtaacctgtcc

atgatttgtttcgtcttcattttgatcttatcgcgatactcccgctcgtg

ttgataacgtccgtgtgtgttcagGGTGGAAATAACGCGGGACACACTGT

GGTCGTGGACTCGGTCGAGTATGACTTCCACCTGCTGCCCAGCGGAGTTC

TCAACAAAAAGGCCACTTCCTTTATTGgtattgttcgtttgaccttcctg

ttaaattatttgttgttttgctgccccctagattgtactattagtaagat

cttagtactgttcgactcattgcgttttggatcagatgttgcccgtgtat

gttgatcttgatcttgttttgtctcacagGAAATGGTGTTGTGATACACC

TGCCAGGACTCTTTGACGAGGCAGAGAAGAACTTGCAGAAGGGCAATGgt

aagtgtttcaatccacaatctggatattgagtaaaatacattaaatgtat

gtgttgtagtatttgtgtatcagtagcggacctgcattgttttgcaaaac

aatagaaattgtgaccaataaaaaatatgaaaattattcaataagctaat

cttccttacattgttgtgatggcaagtattttaagacacaaagaaatgtg

aggtggaaaaagtagtggttaaattagttatatattatatgtgca